Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0030305

Physical Location & Seq

Genomic Coordinates Reverse (-)

87850683 .. 87850948

Gene Structure 266 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ35614

Sequence Viewer

CDS Protein Promoter (2k)

Length: 132 bp

ATGTACTCTAGCATTTTTGGAGGAATAACAACAGATACAGCTACTATGGTTATCCTTATTGATGATCACATGGTCCGCAGAGGGCATGGGGTTTTCAACACTGCTGTTATAAGGGATGGATATCTGTACTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0006082 GO:0006520 GO:0006725 GO:0006807 GO:0008150 GO:0008152 GO:0008153 GO:0008652 GO:0009058 GO:0009072 GO:0009073 GO:0009507 GO:0009532 GO:0009536 GO:0009570 GO:0009987 GO:0016053 GO:0019438 GO:0019752 GO:0032787 GO:0042537 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043436 GO:0044237 GO:0044238 GO:0044249 GO:0044281 GO:0044283 GO:0044422 GO:0044424 GO:0044434 GO:0044435 GO:0044444 GO:0044446 GO:0044464 GO:0046394 GO:0046482 GO:0071704 GO:0072330 GO:1901360 GO:1901362 GO:1901564 GO:1901566 GO:1901576

KEGG Pathways

Metabolic & Signaling

ko00790 map00790

Pfam Domains

Protein Families

Aminotran_4

Protein Analysis

43

Amino Acids

4.81

Weight (kDa)

5.95

Isoelectric Point (pI)

26.62

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0030305)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr5g0081911
rosa_laevigata	RLG00000003986

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	110
AciI	CCGC	1 cut(s)	76
AfaI	GTAC	2 cut(s)	5, 128
AgsI	TTSAA	1 cut(s)	97
AluBI	AGCT	1 cut(s)	41
AluI	AGCT	1 cut(s)	41
AspS9I	GGNCC	1 cut(s)	73
AvaII	GGWCC	1 cut(s)	73
BccI	CCATC	1 cut(s)	110
BclI	TGATCA	1 cut(s)	64
BfaI	CTAG	2 cut(s)	9, 130
Bme18I	GGWCC	1 cut(s)	73
BmgT120I	GGNCC	1 cut(s)	73
BsaBI	GATNNNNATC	1 cut(s)	120
Bse8I	GATNNNNATC	1 cut(s)	120
BseGI	GGATG	1 cut(s)	121
BseJI	GATNNNNATC	1 cut(s)	120
Bsp143I	GATC	1 cut(s)	64
BspACI	CCGC	1 cut(s)	76
BssMI	GATC	1 cut(s)	64
BstF5I	GGATG	1 cut(s)	121
BstKTI	GATC	1 cut(s)	67
BstMBI	GATC	1 cut(s)	64
BtsCI	GGATG	1 cut(s)	121
BtsI	GCAGTG	1 cut(s)	99
BtsIMutI	CAGTG	1 cut(s)	99
Cfr13I	GGNCC	1 cut(s)	73
Csp6I	GTAC	2 cut(s)	4, 127
CviAII	CATG	2 cut(s)	70, 86
CviJI	RGCY	1 cut(s)	41
CviKI_1	RGCY	1 cut(s)	41
CviQI	GTAC	2 cut(s)	4, 127
DpnI	GATC	1 cut(s)	66
DpnII	GATC	1 cut(s)	64
Eco32I	GATATC	1 cut(s)	122
Eco47I	GGWCC	1 cut(s)	73
EcoRV	GATATC	1 cut(s)	122
FaeI	CATG	2 cut(s)	73, 89
FaiI	YATR	4 cut(s)	47, 71, 87, 110
FatI	CATG	2 cut(s)	69, 85
FbaI	TGATCA	1 cut(s)	64
FokI	GGATG	1 cut(s)	128
FspBI	CTAG	2 cut(s)	9, 130
Hin1II	CATG	2 cut(s)	73, 89
Hsp92II	CATG	2 cut(s)	73, 89
Ksp22I	TGATCA	1 cut(s)	64
Kzo9I	GATC	1 cut(s)	64
MaeI	CTAG	2 cut(s)	9, 130
MalI	GATC	1 cut(s)	66
MboI	GATC	1 cut(s)	64
MnlI	CCTC	2 cut(s)	14, 74
NdeII	GATC	1 cut(s)	64
NlaIII	CATG	2 cut(s)	73, 89
PsiI	TTATAA	1 cut(s)	110
PspPI	GGNCC	1 cut(s)	73
RsaI	GTAC	2 cut(s)	5, 128
RsaNI	GTAC	2 cut(s)	4, 127
Sau3AI	GATC	1 cut(s)	64
Sau96I	GGNCC	1 cut(s)	73
SetI	ASST	1 cut(s)	43
SgeI	CNNG	3 cut(s)	21, 82, 98
SinI	GGWCC	1 cut(s)	73
SsiI	CCGC	1 cut(s)	76
SspMI	CTAG	2 cut(s)	9, 130
TatI	WGTACW	2 cut(s)	3, 126
TscAI	CASTG	1 cut(s)	106
TspRI	CASTG	1 cut(s)	106
VpaK11BI	GGWCC	1 cut(s)	73
XspI	CTAG	2 cut(s)	9, 130

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.