RchiOBHm_Chr5g0081971

CMP-sialic acid transporter

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
87868905 .. 87872430
3526 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ35619

Sequence Viewer

Length: 147 bp
ATGGAGTACAGGAAGCTCAAAGATCAGGATGAAAATGGAAATTCAGCTGCCGACGACATAAAAAATTTACGGGGAAATCCGCTTTCTATTGCACCAACTATGGGAGATGGGTCAATAGACCAAAAATGGAAGCACAAGTATGATTGA

Protein Analysis

48

Amino Acids

5.46

Weight (kDa)

5.65

Isoelectric Point (pI)

12.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0030146)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr5g0081971 RchiOBHm_Chr5g0082291

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 80
AcsI RAATTY 2 cut(s) 40, 64
AfaI GTAC 1 cut(s) 8
AfiI CCNNNNNNNGG 1 cut(s) 101
AluBI AGCT 2 cut(s) 16, 47
AluI AGCT 2 cut(s) 16, 47
ApeKI GCWGC 1 cut(s) 47
ApoI RAATTY 2 cut(s) 40, 64
BbvI GCAGC 1 cut(s) 34
BccI CCATC 1 cut(s) 101
BisI GCNGC 1 cut(s) 48
BlsI GCNGC 1 cut(s) 49
Bsc4I CCNNNNNNNGG 1 cut(s) 101
BseGI GGATG 1 cut(s) 34
BseLI CCNNNNNNNGG 1 cut(s) 101
BseXI GCAGC 1 cut(s) 34
BslI CCNNNNNNNGG 1 cut(s) 101
Bsp143I GATC 1 cut(s) 22
BspACI CCGC 1 cut(s) 80
BssMI GATC 1 cut(s) 22
BstF5I GGATG 1 cut(s) 34
BstKTI GATC 1 cut(s) 25
BstMBI GATC 1 cut(s) 22
BstV1I GCAGC 1 cut(s) 34
BtsCI GGATG 1 cut(s) 34
Csp6I GTAC 1 cut(s) 7
CviJI RGCY 2 cut(s) 16, 47
CviKI_1 RGCY 2 cut(s) 16, 47
CviQI GTAC 1 cut(s) 7
DpnI GATC 1 cut(s) 24
DpnII GATC 1 cut(s) 22
FaiI YATR 3 cut(s) 59, 101, 141
Fnu4HI GCNGC 1 cut(s) 48
FokI GGATG 1 cut(s) 41
Fsp4HI GCNGC 1 cut(s) 48
GluI GCNGC 1 cut(s) 48
Hpy188III TCNNGA 1 cut(s) 26
Hpy99I CGWCG 1 cut(s) 56
HpyCH4V TGCA 1 cut(s) 92
Kzo9I GATC 1 cut(s) 22
LpnPI CCDG 1 cut(s) 11
Lsp1109I GCAGC 1 cut(s) 34
MalI GATC 1 cut(s) 24
MboI GATC 1 cut(s) 22
MluCI AATT 2 cut(s) 40, 64
MslI CAYNNNNRTG 1 cut(s) 138
MspA1I CMGCKG 1 cut(s) 47
NdeII GATC 1 cut(s) 22
PkrI GCNGC 1 cut(s) 49
PvuII CAGCTG 1 cut(s) 47
RsaI GTAC 1 cut(s) 8
RsaNI GTAC 1 cut(s) 7
RseI CAYNNNNRTG 1 cut(s) 138
SatI GCNGC 1 cut(s) 48
Sau3AI GATC 1 cut(s) 22
SetI ASST 2 cut(s) 18, 49
SgeI CNNG 3 cut(s) 22, 38, 83
SmiMI CAYNNNNRTG 1 cut(s) 138
Sse9I AATT 2 cut(s) 40, 64
SsiI CCGC 1 cut(s) 80
TasI AATT 2 cut(s) 40, 64
TatI WGTACW 1 cut(s) 6
TseI GCWGC 1 cut(s) 47
TspDTI ATGAA 1 cut(s) 45
XapI RAATTY 2 cut(s) 40, 64
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.