Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0020979

Physical Location & Seq

Genomic Coordinates Forward (+)

15406381 .. 15406686

Gene Structure 306 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ23353

Sequence Viewer

CDS Protein Promoter (2k)

Length: 306 bp

ATGGATAAATCCAAGCGAATCTTTCTTAAATCCAAGCGATCTTTTCGTAGGCGTTTGCCTCCGATCCAATCGGGGGATCGAATTGATTATAGAAACATGAGTTTAATTAGTCGATTTATTAGCGAACAAGGAAAAATATTATCTAGACGGGTGAATCGATTGACCTTAAAACAACAACGATTAATTACTATTGCTATAAAACAAGCTCGTATTTTATCTCCGTTACCTTTTCTTAATAATGAGAAACAATTTGAAAGAAGCGAGTCAACCGCTAGAACTACTGGTCTTATAACCAGAAAAAAATAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003735 GO:0005198 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005829 GO:0005840 GO:0006412 GO:0006518 GO:0006807 GO:0008150 GO:0008152 GO:0009058 GO:0009059 GO:0009507 GO:0009526 GO:0009532 GO:0009536 GO:0009570 GO:0009941 GO:0009987 GO:0010467 GO:0015935 GO:0019538 GO:0022626 GO:0022627 GO:0031967 GO:0031975 GO:0032991 GO:0034641 GO:0034645 GO:0043043 GO:0043170 GO:0043226 GO:0043227 GO:0043228 GO:0043229 GO:0043231 GO:0043232 GO:0043603 GO:0043604 GO:0044237 GO:0044238 GO:0044249 GO:0044260 GO:0044267 GO:0044271 GO:0044391 GO:0044422 GO:0044424 GO:0044434 GO:0044435 GO:0044444 GO:0044445 GO:0044446 GO:0044464 GO:0071704 GO:1901564 GO:1901566 GO:1901576 GO:1990904

KEGG Pathways

Metabolic & Signaling

ko03010 map03010

Pfam Domains

Protein Families

Ribosomal_S18

Protein Analysis

101

Amino Acids

11.97

Weight (kDa)

11.91

Isoelectric Point (pI)

79.1

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Ribosomal_S18	PF01084	26 - 72	1.5e-18	Ribosomal protein S18

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020979)

Species	Orthologous Gene IDs
arabidopsis_thaliana	ATCG00650
pyrus_communis	pycom06g06250
rosa_chinensis	RchiOBHm_Chr6g0260411 RchiOBHm_CPg0502011
rosa_wichuraiana	Rw5G040390

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	290
AciI	CCGC	1 cut(s)	270
AclWI	GGATC	2 cut(s)	58, 84
AfiI	CCNNNNNNNGG	1 cut(s)	73
AgsI	TTSAA	1 cut(s)	254
AluBI	AGCT	1 cut(s)	206
AluI	AGCT	1 cut(s)	206
AlwI	GGATC	2 cut(s)	58, 84
AseI	ATTAAT	1 cut(s)	182
AsuHPI	GGTGA	1 cut(s)	163
BfaI	CTAG	2 cut(s)	144, 273
Bsa29I	ATCGAT	1 cut(s)	157
Bsc4I	CCNNNNNNNGG	1 cut(s)	73
Bse1I	ACTGG	1 cut(s)	286
BseCI	ATCGAT	1 cut(s)	157
BseLI	CCNNNNNNNGG	1 cut(s)	73
BseNI	ACTGG	1 cut(s)	286
BshVI	ATCGAT	1 cut(s)	157
BslI	CCNNNNNNNGG	1 cut(s)	73
Bsp143I	GATC	3 cut(s)	38, 63, 76
BspACI	CCGC	1 cut(s)	270
BspDI	ATCGAT	1 cut(s)	157
BspPI	GGATC	2 cut(s)	58, 84
BsrI	ACTGG	1 cut(s)	286
BssMI	GATC	3 cut(s)	38, 63, 76
BstKTI	GATC	3 cut(s)	41, 66, 79
BstMBI	GATC	3 cut(s)	38, 63, 76
Bsu15I	ATCGAT	1 cut(s)	157
BsuTUI	ATCGAT	1 cut(s)	157
ClaI	ATCGAT	1 cut(s)	157
CviAII	CATG	1 cut(s)	97
CviJI	RGCY	1 cut(s)	206
CviKI_1	RGCY	1 cut(s)	206
DpnI	GATC	3 cut(s)	40, 65, 78
DpnII	GATC	3 cut(s)	38, 63, 76
FaeI	CATG	1 cut(s)	100
FaiI	YATR	4 cut(s)	90, 98, 197, 290
FalI	AAGNNNNNCTT	1 cut(s)	37
FatI	CATG	1 cut(s)	96
FspBI	CTAG	2 cut(s)	144, 273
Hin1II	CATG	1 cut(s)	100
HincII	GTYRAC	1 cut(s)	267
HindII	GTYRAC	1 cut(s)	267
HinfI	GANTC	3 cut(s)	18, 154, 263
HphI	GGTGA	1 cut(s)	163
Hpy166II	GTNNAC	1 cut(s)	267
Hpy188I	TCNGA	1 cut(s)	63
Hpy188III	TCNNGA	1 cut(s)	144
Hpy8I	GTNNAC	1 cut(s)	267
Hsp92II	CATG	1 cut(s)	100
Kzo9I	GATC	3 cut(s)	38, 63, 76
LpnPI	CCDG	1 cut(s)	267
MaeI	CTAG	2 cut(s)	144, 273
MaeIII	GTNAC	1 cut(s)	222
MalI	GATC	3 cut(s)	40, 65, 78
MboI	GATC	3 cut(s)	38, 63, 76
MluCI	AATT	4 cut(s)	81, 105, 183, 248
MlyI	GAGTC	1 cut(s)	272
MnlI	CCTC	1 cut(s)	69
MseI	TTAA	5 cut(s)	27, 104, 167, 182, 234
NdeII	GATC	3 cut(s)	38, 63, 76
NlaIII	CATG	1 cut(s)	100
PcsI	WCGNNNNNNNCGW	1 cut(s)	154
PfeI	GAWTC	2 cut(s)	18, 154
PleI	GAGTC	1 cut(s)	271
PpsI	GAGTC	1 cut(s)	271
PshBI	ATTAAT	1 cut(s)	182
PsiI	TTATAA	1 cut(s)	290
SaqAI	TTAA	5 cut(s)	27, 104, 167, 182, 234
Sau3AI	GATC	3 cut(s)	38, 63, 76
SchI	GAGTC	1 cut(s)	272
SetI	ASST	3 cut(s)	167, 208, 229
Sse9I	AATT	4 cut(s)	81, 105, 183, 248
SsiI	CCGC	1 cut(s)	270
SspI	AATATT	1 cut(s)	138
SspMI	CTAG	2 cut(s)	144, 273
TaqI	TCGA	3 cut(s)	79, 112, 157
TasI	AATT	4 cut(s)	81, 105, 183, 248
TfiI	GAWTC	2 cut(s)	18, 154
Tru1I	TTAA	5 cut(s)	27, 104, 167, 182, 234
Tru9I	TTAA	5 cut(s)	27, 104, 167, 182, 234
TspGWI	ACGGA	1 cut(s)	210
VspI	ATTAAT	1 cut(s)	182
XbaI	TCTAGA	1 cut(s)	143
XspI	CTAG	2 cut(s)	144, 273

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.