RchiOBHm_Chr6g0268201

Belongs to the glycosyltransferase 31 family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Forward (+)
25025918 .. 25029506
3589 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ24056

Sequence Viewer

Length: 132 bp
ATGAAACTTACCTTAGTGGTATCTGGAGTTCTGGACCATGTACACAATGCAACATCCAACAGCATTTTAGATCAAGCCATTGATTCAGAAGAATCTCAACACAAAGACTTCCTCAAGCTGGGAACACATTGA

Protein Analysis

43

Amino Acids

4.73

Weight (kDa)

5.61

Isoelectric Point (pI)

41.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0030353)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr6g0268201
rosa_samantha Rh6AG159600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 42
AfiI CCNNNNNNNGG 1 cut(s) 118
AluBI AGCT 1 cut(s) 118
AluI AGCT 1 cut(s) 118
AspS9I GGNCC 1 cut(s) 34
AvaII GGWCC 1 cut(s) 34
Bme18I GGWCC 1 cut(s) 34
BmgT120I GGNCC 1 cut(s) 34
BpmI CTGGAG 1 cut(s) 45
BpuEI CTTGAG 1 cut(s) 98
Bsc4I CCNNNNNNNGG 1 cut(s) 118
BseGI GGATG 1 cut(s) 53
BseLI CCNNNNNNNGG 1 cut(s) 118
BseYI CCCAGC 1 cut(s) 118
BslI CCNNNNNNNGG 1 cut(s) 118
Bsp1407I TGTACA 1 cut(s) 40
Bsp143I GATC 1 cut(s) 70
BsrGI TGTACA 1 cut(s) 40
BssMI GATC 1 cut(s) 70
BstAUI TGTACA 1 cut(s) 40
BstDEI CTNAG 1 cut(s) 13
BstF5I GGATG 1 cut(s) 53
BstKTI GATC 1 cut(s) 73
BstMBI GATC 1 cut(s) 70
BtsCI GGATG 1 cut(s) 53
Cfr13I GGNCC 1 cut(s) 34
Csp6I GTAC 1 cut(s) 41
CviAII CATG 1 cut(s) 38
CviJI RGCY 2 cut(s) 77, 118
CviKI_1 RGCY 2 cut(s) 77, 118
CviQI GTAC 1 cut(s) 41
DdeI CTNAG 1 cut(s) 13
DpnI GATC 1 cut(s) 72
DpnII GATC 1 cut(s) 70
Eco47I GGWCC 1 cut(s) 34
FaeI CATG 1 cut(s) 41
FaiI YATR 1 cut(s) 39
FatI CATG 1 cut(s) 37
FokI GGATG 1 cut(s) 40
GsaI CCCAGC 1 cut(s) 122
GsuI CTGGAG 1 cut(s) 45
Hin1II CATG 1 cut(s) 41
HinfI GANTC 2 cut(s) 83, 92
Hpy166II GTNNAC 1 cut(s) 43
Hpy188I TCNGA 1 cut(s) 88
Hpy188III TCNNGA 2 cut(s) 24, 32
Hpy8I GTNNAC 1 cut(s) 43
HpyCH4V TGCA 1 cut(s) 50
HpyF3I CTNAG 1 cut(s) 13
Hsp92II CATG 1 cut(s) 41
Kzo9I GATC 1 cut(s) 70
LpnPI CCDG 3 cut(s) 9, 17, 104
MalI GATC 1 cut(s) 72
MboI GATC 1 cut(s) 70
MboII GAAGA 1 cut(s) 101
MmeI TCCRAC 1 cut(s) 81
MnlI CCTC 1 cut(s) 122
NdeII GATC 1 cut(s) 70
NlaIII CATG 1 cut(s) 41
PfeI GAWTC 2 cut(s) 83, 92
PspFI CCCAGC 1 cut(s) 118
PspPI GGNCC 1 cut(s) 34
PsrI GAACNNNNNNTAC 2 cut(s) 12, 44
RsaI GTAC 1 cut(s) 42
RsaNI GTAC 1 cut(s) 41
Sau3AI GATC 1 cut(s) 70
Sau96I GGNCC 1 cut(s) 34
SetI ASST 2 cut(s) 14, 120
SgeI CNNG 5 cut(s) 36, 44, 50, 86, 127
SinI GGWCC 1 cut(s) 34
SmlI CTYRAG 1 cut(s) 113
SmoI CTYRAG 1 cut(s) 113
TatI WGTACW 1 cut(s) 40
TfiI GAWTC 2 cut(s) 83, 92
TspDTI ATGAA 1 cut(s) 17
VpaK11BI GGWCC 1 cut(s) 34
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.