RchiOBHm_Chr6g0268401

Thioredoxin-like 1-2, chloroplastic

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
OG0030326
Physical Location & Seq
Forward (+)
25267596 .. 25270889
3294 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ24076

Sequence Viewer

Length: 162 bp
ATGAAATCTTGGATATGTATAGGGTTTCAGGCTCAAGCATCAATCTGTGTAAGCAAAGCTATGAAATGGTGGGAGAAAACCCTAAAACTGAACATGGTGGAGATCCATTCTGCTAAGAACTCATTGATTCTTTGCATAATGCTGGTGATAGATTGGTTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0009507 GO:0009536 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Thioredoxin

Protein Analysis

53

Amino Acids

6.15

Weight (kDa)

8.99

Isoelectric Point (pI)

17.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0030326)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr6g0267821 RchiOBHm_Chr6g0268401

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 97
AluBI AGCT 1 cut(s) 59
AluI AGCT 1 cut(s) 59
AlwI GGATC 1 cut(s) 97
AsuHPI GGTGA 1 cut(s) 157
BmsI GCATC 1 cut(s) 47
BpuEI CTTGAG 1 cut(s) 18
Bsp143I GATC 1 cut(s) 102
BspPI GGATC 1 cut(s) 97
BssMI GATC 1 cut(s) 102
BstDEI CTNAG 1 cut(s) 114
BstKTI GATC 1 cut(s) 105
BstMBI GATC 1 cut(s) 102
BstX2I RGATCY 1 cut(s) 102
BstYI RGATCY 1 cut(s) 102
CviAII CATG 1 cut(s) 94
CviJI RGCY 2 cut(s) 32, 59
CviKI_1 RGCY 2 cut(s) 32, 59
DdeI CTNAG 1 cut(s) 114
DpnI GATC 1 cut(s) 104
DpnII GATC 1 cut(s) 102
FaeI CATG 1 cut(s) 97
FaiI YATR 5 cut(s) 16, 20, 62, 95, 137
FatI CATG 1 cut(s) 93
Hin1II CATG 1 cut(s) 97
HinfI GANTC 1 cut(s) 127
HphI GGTGA 1 cut(s) 157
HpyCH4V TGCA 1 cut(s) 135
HpyF3I CTNAG 1 cut(s) 114
Hsp92II CATG 1 cut(s) 97
Kzo9I GATC 1 cut(s) 102
LpnPI CCDG 2 cut(s) 14, 128
LweI GCATC 1 cut(s) 47
MalI GATC 1 cut(s) 104
MboI GATC 1 cut(s) 102
MflI RGATCY 1 cut(s) 102
NdeII GATC 1 cut(s) 102
NlaIII CATG 1 cut(s) 97
PfeI GAWTC 1 cut(s) 127
PsuI RGATCY 1 cut(s) 102
Sau3AI GATC 1 cut(s) 102
SetI ASST 1 cut(s) 61
SfaNI GCATC 1 cut(s) 47
SgeI CNNG 5 cut(s) 21, 41, 47, 106, 155
SmlI CTYRAG 1 cut(s) 33
SmoI CTYRAG 1 cut(s) 33
TfiI GAWTC 1 cut(s) 127
TspDTI ATGAA 2 cut(s) 17, 77
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.