RchiOBHm_Chr6g0289531

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Reverse (-)
52572234 .. 52574851
2618 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ25974

Sequence Viewer

Length: 189 bp
ATGAATGACTCTTCTTCTCTGAATTTCTTGACTGCCAATTCTAATCCCCTTAACGGAGTGGCGGCGGCTAAGTGGCTTATGCTCAAGCGAACTCAAGATTGCGACCTGATCAGTAGTGCACCTGATGTGGAAAGAAAGAAGGTTGGCTGGAACAACTTTCTCAAGGAATCTGAAAAATTTCTCATATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

62

Amino Acids

6.96

Weight (kDa)

7.88

Isoelectric Point (pI)

33.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024826)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0134231 RchiOBHm_Chr6g0289531
rosa_samantha Rh6CG328900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 62, 65
AcsI RAATTY 2 cut(s) 22, 176
AfiI CCNNNNNNNGG 1 cut(s) 53
Alw21I GWGCWC 1 cut(s) 121
Alw44I GTGCAC 1 cut(s) 117
ApaLI GTGCAC 1 cut(s) 117
ApoI RAATTY 2 cut(s) 22, 176
Asp700I GAANNNNTTC 1 cut(s) 177
BaeGI GKGCMC 1 cut(s) 121
Bbv12I GWGCWC 1 cut(s) 121
BclI TGATCA 1 cut(s) 108
BisI GCNGC 2 cut(s) 63, 66
BlsI GCNGC 2 cut(s) 64, 67
BpuEI CTTGAG 3 cut(s) 68, 78, 146
Bsc4I CCNNNNNNNGG 1 cut(s) 53
BseLI CCNNNNNNNGG 1 cut(s) 53
BseSI GKGCMC 1 cut(s) 121
BsiHKAI GWGCWC 1 cut(s) 121
BslI CCNNNNNNNGG 1 cut(s) 53
Bsp1286I GDGCHC 1 cut(s) 121
Bsp143I GATC 1 cut(s) 108
BspACI CCGC 2 cut(s) 62, 65
BssMI GATC 1 cut(s) 108
Bst6I CTCTTC 1 cut(s) 16
BstDEI CTNAG 1 cut(s) 69
BstKTI GATC 1 cut(s) 111
BstMBI GATC 1 cut(s) 108
BstSLI GKGCMC 1 cut(s) 121
CviJI RGCY 3 cut(s) 68, 76, 147
CviKI_1 RGCY 3 cut(s) 68, 76, 147
DdeI CTNAG 1 cut(s) 69
DpnI GATC 1 cut(s) 110
DpnII GATC 1 cut(s) 108
Eam1104I CTCTTC 1 cut(s) 16
EarI CTCTTC 1 cut(s) 16
FaiI YATR 3 cut(s) 80, 185, 187
FauNDI CATATG 1 cut(s) 185
FbaI TGATCA 1 cut(s) 108
Fnu4HI GCNGC 2 cut(s) 63, 66
Fsp4HI GCNGC 2 cut(s) 63, 66
GluI GCNGC 2 cut(s) 63, 66
HinfI GANTC 2 cut(s) 8, 167
Hpy166II GTNNAC 1 cut(s) 119
Hpy188I TCNGA 2 cut(s) 21, 172
Hpy188III TCNNGA 2 cut(s) 28, 95
Hpy8I GTNNAC 1 cut(s) 119
HpyAV CCTTC 1 cut(s) 133
HpyCH4V TGCA 1 cut(s) 119
HpyF3I CTNAG 1 cut(s) 69
Ksp22I TGATCA 1 cut(s) 108
Kzo9I GATC 1 cut(s) 108
LpnPI CCDG 3 cut(s) 119, 133, 135
MalI GATC 1 cut(s) 110
MboI GATC 1 cut(s) 108
MboII GAAGA 2 cut(s) 3, 6
MhlI GDGCHC 1 cut(s) 121
MluCI AATT 3 cut(s) 22, 37, 176
MlyI GAGTC 1 cut(s) 2
MroXI GAANNNNTTC 1 cut(s) 177
MseI TTAA 1 cut(s) 51
NdeI CATATG 1 cut(s) 185
NdeII GATC 1 cut(s) 108
PdmI GAANNNNTTC 1 cut(s) 177
PfeI GAWTC 1 cut(s) 167
PkrI GCNGC 2 cut(s) 64, 67
PleI GAGTC 1 cut(s) 2
PpsI GAGTC 1 cut(s) 2
SaqAI TTAA 1 cut(s) 51
SatI GCNGC 2 cut(s) 63, 66
Sau3AI GATC 1 cut(s) 108
SchI GAGTC 1 cut(s) 2
SduI GDGCHC 1 cut(s) 121
SetI ASST 3 cut(s) 108, 124, 144
SgeI CNNG 7 cut(s) 40, 97, 107, 118, 134, 160, 175
SmlI CTYRAG 3 cut(s) 83, 93, 161
SmoI CTYRAG 3 cut(s) 83, 93, 161
Sse9I AATT 3 cut(s) 22, 37, 176
SsiI CCGC 2 cut(s) 62, 65
TasI AATT 3 cut(s) 22, 37, 176
TauI GCSGC 2 cut(s) 65, 68
TfiI GAWTC 1 cut(s) 167
Tru1I TTAA 1 cut(s) 51
Tru9I TTAA 1 cut(s) 51
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 1 cut(s) 69
VneI GTGCAC 1 cut(s) 117
XapI RAATTY 2 cut(s) 22, 176
XmnI GAANNNNTTC 1 cut(s) 177
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.