RchiOBHm_Chr6g0307461

Belongs to the peptidase S10 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
OG0025084
Physical Location & Seq
Reverse (-)
65836334 .. 65837816
1483 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ27642

Sequence Viewer

Length: 690 bp
ATGTATGCACGTATATATGCTACTTATTTTGGAAGCAATGTGCAGATCGGAAATGCTTGGATCGATGATAATCATGGTGAAATGGGTATTTATGAATATTTGTGGAAACATGCTTTGAACTCTGATGAAACCTATGAAGGCATTTACAAATATTGTGACTTTGTATCTGATATTTTCTCGAGCAAGTGCACAAAATATCAAATTCAAGCAAGTGATGAGCCTGGAGACGTTGATATTTACAACATCTACGCTCCACTTTGCAAAATATCATCCTCATCAAATACCACATACATCTCAATTGGTTCTATGGTTAATGGATTTGATCCATGCTCAGACTATTATGTCGATGCCTCCCTAAATCTTAAGGAGGTCCAAGGTTCATGTAAAACCTACACATTGGTCGGCTTGCAGATAATTAATACAAAATTAAATAGACATTTTAATCAATTTCTTTTCCTCATTTCTTATATTATTCACTTTACTTCTCTTTTTCTTTTTCTAATATATAGTGCTATTGGATGGACAGACAGCCCACAAAGTGACAAAGTGTCTCCTAGAAAGTGGGATAACTGCGTGGAAGATATGTTACTCAGTTATTGGTTACAAAGGGGGTTGACATTTGCTACTGTAAGAGGAGCTGACCTGGTCATATGGTTCCTAGCTATCAACCAAAGTGAGCACTCACCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Peptidase_S10

Protein Analysis

229

Amino Acids

26.27

Weight (kDa)

4.87

Isoelectric Point (pI)

31.54

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Peptidase_S10 PF00450 14 - 127 1.5e-11 Serine carboxypeptidase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0025084)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr6g0307461
rosa_rugosa Rorug06G0358700
rosa_samantha Rh6BG478700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 341
AclWI GGATC 2 cut(s) 68, 317
AcsI RAATTY 1 cut(s) 201
AdeI CACNNNGTG 1 cut(s) 539
AflII CTTAAG 1 cut(s) 362
AgsI TTSAA 2 cut(s) 118, 206
AhdI GACNNNNNGTC 1 cut(s) 547
AjnI CCWGG 2 cut(s) 220, 642
AluBI AGCT 2 cut(s) 638, 662
AluI AGCT 2 cut(s) 638, 662
Alw21I GWGCWC 2 cut(s) 191, 681
Alw26I GTCTC 2 cut(s) 219, 555
Alw44I GTGCAC 1 cut(s) 187
AlwI GGATC 2 cut(s) 68, 317
Ama87I CYCGRG 1 cut(s) 178
ApaLI GTGCAC 1 cut(s) 187
ApoI RAATTY 1 cut(s) 201
AseI ATTAAT 1 cut(s) 417
AspS9I GGNCC 1 cut(s) 370
AsuHPI GGTGA 2 cut(s) 89, 675
AvaI CYCGRG 1 cut(s) 178
AvaII GGWCC 1 cut(s) 370
BaeGI GKGCMC 1 cut(s) 191
BarI GAAGNNNNNNTAC 2 cut(s) 570, 602
Bbv12I GWGCWC 2 cut(s) 191, 681
BccI CCATC 1 cut(s) 513
BciT130I CCWGG 2 cut(s) 222, 644
BcoDI GTCTC 2 cut(s) 219, 555
BfaI CTAG 2 cut(s) 555, 659
BfrI CTTAAG 1 cut(s) 362
Bme1390I CCNGG 2 cut(s) 222, 644
Bme18I GGWCC 1 cut(s) 370
BmeRI GACNNNNNGTC 1 cut(s) 547
BmeT110I CYCGRG 1 cut(s) 178
BmgT120I GGNCC 1 cut(s) 370
BmiI GGNNCC 1 cut(s) 656
BmrFI CCNGG 2 cut(s) 222, 644
BmsI GCATC 1 cut(s) 337
BpmI CTGGAG 1 cut(s) 243
Bsa29I ATCGAT 1 cut(s) 63
BsaAI YACGTR 1 cut(s) 11
BsaBI GATNNNNATC 1 cut(s) 69
BsaJI CCNNGG 1 cut(s) 373
Bse3DI GCAATG 1 cut(s) 43
Bse8I GATNNNNATC 1 cut(s) 69
BseBI CCWGG 2 cut(s) 222, 644
BseCI ATCGAT 1 cut(s) 63
BseDI CCNNGG 1 cut(s) 373
BseGI GGATG 2 cut(s) 269, 524
BseJI GATNNNNATC 1 cut(s) 69
BseMI GCAATG 1 cut(s) 43
BseMII CTCAG 2 cut(s) 345, 604
BseRI GAGGAG 1 cut(s) 648
BseSI GKGCMC 1 cut(s) 191
BsgI GTGCAG 1 cut(s) 62
BshVI ATCGAT 1 cut(s) 63
BsiHKAI GWGCWC 2 cut(s) 191, 681
BsiHKCI CYCGRG 1 cut(s) 178
BsmAI GTCTC 2 cut(s) 219, 555
BsmBI CGTCTC 1 cut(s) 219
BsoBI CYCGRG 1 cut(s) 178
Bsp1286I GDGCHC 2 cut(s) 191, 681
Bsp143I GATC 3 cut(s) 45, 60, 322
BspCNI CTCAG 2 cut(s) 344, 603
BspDI ATCGAT 1 cut(s) 63
BspLI GGNNCC 1 cut(s) 656
BspPI GGATC 2 cut(s) 68, 317
BspTI CTTAAG 1 cut(s) 362
BsrDI GCAATG 1 cut(s) 43
BssECI CCNNGG 1 cut(s) 373
BssMI GATC 3 cut(s) 45, 60, 322
BssT1I CCWWGG 1 cut(s) 373
Bst2UI CCWGG 2 cut(s) 222, 644
Bst4CI ACNGT 1 cut(s) 628
BstAFI CTTAAG 1 cut(s) 362
BstBAI YACGTR 1 cut(s) 11
BstC8I GCNNGC 1 cut(s) 407
BstDEI CTNAG 2 cut(s) 331, 590
BstF5I GGATG 2 cut(s) 269, 524
BstKTI GATC 3 cut(s) 48, 63, 325
BstMAI GTCTC 2 cut(s) 219, 555
BstMBI GATC 3 cut(s) 45, 60, 322
BstNI CCWGG 2 cut(s) 222, 644
BstNSI RCATGY 1 cut(s) 113
BstSCI CCNGG 2 cut(s) 220, 642
BstSLI GKGCMC 1 cut(s) 191
Bsu15I ATCGAT 1 cut(s) 63
BsuTUI ATCGAT 1 cut(s) 63
BtsCI GGATG 2 cut(s) 269, 524
Cac8I GCNNGC 1 cut(s) 407
Cfr13I GGNCC 1 cut(s) 370
ClaI ATCGAT 1 cut(s) 63
CsiI ACCWGGT 1 cut(s) 642
CviAII CATG 4 cut(s) 74, 110, 327, 381
CviJI RGCY 5 cut(s) 220, 405, 531, 638, 662
CviKI_1 RGCY 5 cut(s) 220, 405, 531, 638, 662
DdeI CTNAG 2 cut(s) 331, 590
DpnI GATC 3 cut(s) 47, 62, 324
DpnII GATC 3 cut(s) 45, 60, 322
DraIII CACNNNGTG 1 cut(s) 539
DrdI GACNNNNNNGTC 1 cut(s) 341
DriI GACNNNNNGTC 1 cut(s) 547
DseDI GACNNNNNNGTC 1 cut(s) 341
Eam1105I GACNNNNNGTC 1 cut(s) 547
Eco130I CCWWGG 1 cut(s) 373
Eco47I GGWCC 1 cut(s) 370
Eco88I CYCGRG 1 cut(s) 178
EcoRII CCWGG 2 cut(s) 220, 642
EcoT14I CCWWGG 1 cut(s) 373
ErhI CCWWGG 1 cut(s) 373
Esp3I CGTCTC 1 cut(s) 219
FaeI CATG 4 cut(s) 77, 113, 330, 384
FatI CATG 4 cut(s) 73, 109, 326, 380
FauNDI CATATG 1 cut(s) 650
FokI GGATG 2 cut(s) 256, 531
FspBI CTAG 2 cut(s) 555, 659
GsuI CTGGAG 1 cut(s) 243
Hin1II CATG 4 cut(s) 77, 113, 330, 384
HincII GTYRAC 1 cut(s) 615
HindII GTYRAC 1 cut(s) 615
HphI GGTGA 2 cut(s) 89, 675
Hpy166II GTNNAC 2 cut(s) 189, 615
Hpy188I TCNGA 4 cut(s) 50, 124, 169, 334
Hpy188III TCNNGA 1 cut(s) 178
Hpy8I GTNNAC 2 cut(s) 189, 615
HpyAV CCTTC 1 cut(s) 131
HpyCH4III ACNGT 1 cut(s) 628
HpyCH4IV ACGT 2 cut(s) 10, 228
HpyCH4V TGCA 5 cut(s) 8, 43, 189, 261, 409
HpyF3I CTNAG 2 cut(s) 331, 590
HpySE526I ACGT 2 cut(s) 10, 228
Hsp92II CATG 4 cut(s) 77, 113, 330, 384
Kzo9I GATC 3 cut(s) 45, 60, 322
LmnI GCTCC 2 cut(s) 256, 635
LpnPI CCDG 4 cut(s) 207, 234, 629, 656
LweI GCATC 1 cut(s) 337
MabI ACCWGGT 1 cut(s) 642
MaeI CTAG 2 cut(s) 555, 659
MaeII ACGT 2 cut(s) 10, 228
MaeIII GTNAC 4 cut(s) 155, 539, 585, 600
MalI GATC 3 cut(s) 47, 62, 324
MboI GATC 3 cut(s) 45, 60, 322
MboII GAAGA 1 cut(s) 590
MfeI CAATTG 1 cut(s) 297
MhlI GDGCHC 2 cut(s) 191, 681
MluCI AATT 5 cut(s) 201, 297, 414, 425, 446
MnlI CCTC 5 cut(s) 283, 361, 361, 467, 626
MseI TTAA 5 cut(s) 312, 363, 417, 428, 441
MspCI CTTAAG 1 cut(s) 362
MspR9I CCNGG 2 cut(s) 222, 644
MunI CAATTG 1 cut(s) 297
MvaI CCWGG 2 cut(s) 222, 644
NdeI CATATG 1 cut(s) 650
NdeII GATC 3 cut(s) 45, 60, 322
NlaIII CATG 4 cut(s) 77, 113, 330, 384
NlaIV GGNNCC 1 cut(s) 656
NmuCI GTSAC 2 cut(s) 155, 539
NspI RCATGY 1 cut(s) 113
PaeR7I CTCGAG 1 cut(s) 178
PflFI GACNNNGTC 1 cut(s) 644
Ppu21I YACGTR 1 cut(s) 11
PshBI ATTAAT 1 cut(s) 417
Psp6I CCWGG 2 cut(s) 220, 642
PspGI CCWGG 2 cut(s) 220, 642
PspN4I GGNNCC 1 cut(s) 656
PspPI GGNCC 1 cut(s) 370
PsyI GACNNNGTC 1 cut(s) 644
SaqAI TTAA 5 cut(s) 312, 363, 417, 428, 441
Sau3AI GATC 3 cut(s) 45, 60, 322
Sau96I GGNCC 1 cut(s) 370
ScrFI CCNGG 2 cut(s) 222, 644
SduI GDGCHC 2 cut(s) 191, 681
SexAI ACCWGGT 1 cut(s) 642
SfaNI GCATC 1 cut(s) 337
Sfr274I CTCGAG 1 cut(s) 178
SinI GGWCC 1 cut(s) 370
SlaI CTCGAG 1 cut(s) 178
SmlI CTYRAG 2 cut(s) 178, 362
SmoI CTYRAG 2 cut(s) 178, 362
Sse9I AATT 5 cut(s) 201, 297, 414, 425, 446
SspI AATATT 2 cut(s) 98, 152
SspMI CTAG 2 cut(s) 555, 659
StyD4I CCNGG 2 cut(s) 220, 642
StyI CCWWGG 1 cut(s) 373
TaaI ACNGT 1 cut(s) 628
TaiI ACGT 2 cut(s) 13, 231
TaqI TCGA 3 cut(s) 63, 179, 345
TasI AATT 5 cut(s) 201, 297, 414, 425, 446
Tru1I TTAA 5 cut(s) 312, 363, 417, 428, 441
Tru9I TTAA 5 cut(s) 312, 363, 417, 428, 441
TseFI GTSAC 2 cut(s) 155, 539
Tsp45I GTSAC 2 cut(s) 155, 539
TspDTI ATGAA 4 cut(s) 108, 141, 150, 369
Tth111I GACNNNGTC 1 cut(s) 644
Vha464I CTTAAG 1 cut(s) 362
VneI GTGCAC 1 cut(s) 187
VpaK11BI GGWCC 1 cut(s) 370
VspI ATTAAT 1 cut(s) 417
XapI RAATTY 1 cut(s) 201
XceI RCATGY 1 cut(s) 113
XhoI CTCGAG 1 cut(s) 178
XspI CTAG 2 cut(s) 555, 659
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.