RchiOBHm_Chr7g0184911

Leucine Rich Repeat

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
OG0025120
Physical Location & Seq
Forward (+)
5237855 .. 5240349
2495 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ16498

Sequence Viewer

Length: 279 bp
ATGTCATTCAACACACTTACAGGCATACCTCTTGCTTCATTGTTTTCATTGCCAAACATCAGCTATTTGAATCTGGCTTCAAATTTGTTAAGTGGTTCACTTCCGGGCCATTTAAGCTGTGGCATTAAACTTGATTACATTCATATATCGAACAATAGGTTCACAGCTGACTTGCCTTCTTGTTTGGGACCTGAATCAGAAGAGAGAGTTGTGAATTTTGGTGGGAGTTGCTTATCTGTTAGTACGCAAAATCAGGAACCAGATCATATTGCAATGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LRR_1 LRR_8 Pkinase_Tyr

Protein Analysis

92

Amino Acids

9.84

Weight (kDa)

4.97

Isoelectric Point (pI)

57.81

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LRR_8 PF13855 2 - 54 1.9e-06 Leucine rich repeat
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0025120)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr7g0184911
rosa_samantha Rh7CG071000
rosa_wichuraiana Rw7G005810

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 82, 214
AfaI GTAC 1 cut(s) 244
AgsI TTSAA 3 cut(s) 10, 70, 81
AluBI AGCT 3 cut(s) 63, 117, 167
AluI AGCT 3 cut(s) 63, 117, 167
AoxI GGCC 1 cut(s) 106
ApoI RAATTY 2 cut(s) 82, 214
AspS9I GGNCC 2 cut(s) 106, 188
AsuC2I CCSGG 1 cut(s) 105
AvaII GGWCC 1 cut(s) 188
BcnI CCSGG 1 cut(s) 105
Bme1390I CCNGG 1 cut(s) 105
Bme18I GGWCC 1 cut(s) 188
BmgT120I GGNCC 2 cut(s) 106, 188
BmiI GGNNCC 2 cut(s) 189, 258
BmrFI CCNGG 1 cut(s) 105
BpuMI CCSGG 1 cut(s) 105
Bse3DI GCAATG 2 cut(s) 47, 279
BseMI GCAATG 2 cut(s) 47, 279
BshFI GGCC 1 cut(s) 108
BsiSI CCGG 1 cut(s) 104
BslFI GGGAC 1 cut(s) 201
BsmFI GGGAC 1 cut(s) 201
BsnI GGCC 1 cut(s) 108
Bsp143I GATC 1 cut(s) 262
BspANI GGCC 1 cut(s) 108
BspLI GGNNCC 2 cut(s) 189, 258
BsrDI GCAATG 2 cut(s) 47, 279
BssMI GATC 1 cut(s) 262
Bst6I CTCTTC 1 cut(s) 195
BstKTI GATC 1 cut(s) 265
BstMBI GATC 1 cut(s) 262
BstMWI GCNNNNNNNGC 1 cut(s) 114
BstSCI CCNGG 1 cut(s) 103
BsuRI GGCC 1 cut(s) 108
Cfr13I GGNCC 2 cut(s) 106, 188
Csp6I GTAC 1 cut(s) 243
CviJI RGCY 5 cut(s) 63, 77, 108, 117, 167
CviKI_1 RGCY 5 cut(s) 63, 77, 108, 117, 167
CviQI GTAC 1 cut(s) 243
DpnI GATC 1 cut(s) 264
DpnII GATC 1 cut(s) 262
Eam1104I CTCTTC 1 cut(s) 195
EarI CTCTTC 1 cut(s) 195
Eco47I GGWCC 1 cut(s) 188
EcoO109I RGGNCCY 1 cut(s) 188
FaiI YATR 4 cut(s) 26, 144, 146, 267
FaqI GGGAC 1 cut(s) 201
HaeIII GGCC 1 cut(s) 108
HapII CCGG 1 cut(s) 104
HinfI GANTC 2 cut(s) 70, 194
HpaII CCGG 1 cut(s) 104
Hpy166II GTNNAC 2 cut(s) 98, 162
Hpy188I TCNGA 1 cut(s) 199
Hpy188III TCNNGA 1 cut(s) 254
Hpy8I GTNNAC 2 cut(s) 98, 162
HpyAV CCTTC 1 cut(s) 186
HpyCH4V TGCA 1 cut(s) 272
HpyF10VI GCNNNNNNNGC 1 cut(s) 114
Kzo9I GATC 1 cut(s) 262
LpnPI CCDG 6 cut(s) 6, 59, 117, 204, 239, 273
MalI GATC 1 cut(s) 264
MboI GATC 1 cut(s) 262
MboII GAAGA 1 cut(s) 212
MluCI AATT 2 cut(s) 82, 214
MnlI CCTC 1 cut(s) 39
MseI TTAA 3 cut(s) 89, 113, 126
MspA1I CMGCKG 1 cut(s) 167
MspI CCGG 1 cut(s) 104
MspR9I CCNGG 1 cut(s) 105
MwoI GCNNNNNNNGC 1 cut(s) 114
NciI CCSGG 1 cut(s) 105
NdeII GATC 1 cut(s) 262
NlaIV GGNNCC 2 cut(s) 189, 258
PfeI GAWTC 2 cut(s) 70, 194
PpuMI RGGWCCY 1 cut(s) 188
Psp5II RGGWCCY 1 cut(s) 188
PspN4I GGNNCC 2 cut(s) 189, 258
PspPI GGNCC 2 cut(s) 106, 188
PspPPI RGGWCCY 1 cut(s) 188
PvuII CAGCTG 1 cut(s) 167
RsaI GTAC 1 cut(s) 244
RsaNI GTAC 1 cut(s) 243
SaqAI TTAA 3 cut(s) 89, 113, 126
Sau3AI GATC 1 cut(s) 262
Sau96I GGNCC 2 cut(s) 106, 188
ScrFI CCNGG 1 cut(s) 105
SetI ASST 6 cut(s) 31, 65, 119, 161, 169, 193
SinI GGWCC 1 cut(s) 188
Sse9I AATT 2 cut(s) 82, 214
StyD4I CCNGG 1 cut(s) 103
TaqI TCGA 1 cut(s) 149
TasI AATT 2 cut(s) 82, 214
TfiI GAWTC 2 cut(s) 70, 194
Tru1I TTAA 3 cut(s) 89, 113, 126
Tru9I TTAA 3 cut(s) 89, 113, 126
TspDTI ATGAA 3 cut(s) 27, 36, 131
VpaK11BI GGWCC 1 cut(s) 188
XapI RAATTY 2 cut(s) 82, 214
XcmI CCANNNNNNNNNTGG 1 cut(s) 116
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.