RchiOBHm_Chr7g0198731

Cupin-like domain

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Reverse (-)
16709700 .. 16710060
361 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ17781

Sequence Viewer

Length: 165 bp
ATGAACAATGCTCAAGCTAGATCAAGCACTCACTATGATCCACACCATAACCTTCTCTGCTTAGTTTCTGGCTGTAAACAAGGTCAAATAATTTTCTCTAATCTTTTGAATGTATTGGGCTGCTTCCAACTTCATAGTCATTATATATGTTTATATAAAGAATGA

Protein Analysis

54

Amino Acids

6.16

Weight (kDa)

7.75

Isoelectric Point (pI)

58.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024931)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr3g0456061 RchiOBHm_Chr7g0198731
rosa_samantha Rh7AG075300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 32
AgsI TTSAA 1 cut(s) 109
AluBI AGCT 1 cut(s) 17
AluI AGCT 1 cut(s) 17
AlwI GGATC 1 cut(s) 32
ApeKI GCWGC 1 cut(s) 120
BbvI GCAGC 1 cut(s) 107
BfaI CTAG 1 cut(s) 18
BisI GCNGC 1 cut(s) 121
BlsI GCNGC 1 cut(s) 122
BseXI GCAGC 1 cut(s) 107
Bsp143I GATC 2 cut(s) 20, 37
BspPI GGATC 1 cut(s) 32
BssMI GATC 2 cut(s) 20, 37
BstDEI CTNAG 1 cut(s) 61
BstKTI GATC 2 cut(s) 23, 40
BstMBI GATC 2 cut(s) 20, 37
BstV1I GCAGC 1 cut(s) 107
CviJI RGCY 3 cut(s) 17, 72, 120
CviKI_1 RGCY 3 cut(s) 17, 72, 120
DdeI CTNAG 1 cut(s) 61
DpnI GATC 2 cut(s) 22, 39
DpnII GATC 2 cut(s) 20, 37
FaiI YATR 8 cut(s) 36, 48, 135, 144, 146, 148, 154, 156
Fnu4HI GCNGC 1 cut(s) 121
Fsp4HI GCNGC 1 cut(s) 121
FspBI CTAG 1 cut(s) 18
FspEI CC 8 cut(s) 54, 54, 59, 65, 66, 101, 102, 140
GluI GCNGC 1 cut(s) 121
Hpy166II GTNNAC 1 cut(s) 77
Hpy8I GTNNAC 1 cut(s) 77
HpyAV CCTTC 1 cut(s) 62
HpyF3I CTNAG 1 cut(s) 61
Kzo9I GATC 2 cut(s) 20, 37
LpnPI CCDG 1 cut(s) 54
Lsp1109I GCAGC 1 cut(s) 107
MaeI CTAG 1 cut(s) 18
MalI GATC 2 cut(s) 22, 39
MboI GATC 2 cut(s) 20, 37
MluCI AATT 1 cut(s) 90
MmeI TCCRAC 1 cut(s) 151
NdeII GATC 2 cut(s) 20, 37
PkrI GCNGC 1 cut(s) 122
SatI GCNGC 1 cut(s) 121
Sau3AI GATC 2 cut(s) 20, 37
SetI ASST 3 cut(s) 19, 54, 85
SgeI CNNG 5 cut(s) 26, 30, 36, 81, 92
SmlI CTYRAG 1 cut(s) 12
SmoI CTYRAG 1 cut(s) 12
Sse9I AATT 1 cut(s) 90
SspMI CTAG 1 cut(s) 18
TasI AATT 1 cut(s) 90
TseI GCWGC 1 cut(s) 120
TspDTI ATGAA 2 cut(s) 17, 122
XspI CTAG 1 cut(s) 18
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.