Rh7AG075300

Cupin-like domain

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
Physical Location & Seq
Forward (+)
5365523 .. 5367345
1823 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG075300.1

Sequence Viewer

Length: 297 bp
ATGGAGGCCAGGGTTTCCATCTCTGCACCAGGCGTTCTCCTCCTCCGCCTTTGGAAGAATTATCCTGCATTTTTGGAGGATAAATCACTAATTCCTGTCAACCTCTGGATGAACAATGCTCAAGCTAGATCAAGCACTCACTATGATCCACACCATAACCTTCTCTGCTTAGTTTCTGGCTGTAAACAAGAGATGGTTAAAACATCATCACAACTTAGGACGAAAACAGCAAAGCTGAAGAAGCGAAACAGAATAAGACAGATAAGATCTACAACCGATAGAAAGATTCATCTGTGA

Protein Analysis

98

Amino Acids

11.35

Weight (kDa)

10.58

Isoelectric Point (pI)

63.71

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Cupin_8 PF13621 31 - 63 4.2e-09 Cupin-like domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024931)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr3g0456061 RchiOBHm_Chr7g0198731
rosa_samantha Rh7AG075300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 46
AclWI GGATC 1 cut(s) 140
AcuI CTGAAG 1 cut(s) 257
AjnI CCWGG 2 cut(s) 8, 28
AluBI AGCT 2 cut(s) 125, 235
AluI AGCT 2 cut(s) 125, 235
AlwI GGATC 1 cut(s) 140
AoxI GGCC 1 cut(s) 6
BccI CCATC 2 cut(s) 26, 187
BciT130I CCWGG 2 cut(s) 10, 30
BfaI CTAG 1 cut(s) 126
BglII AGATCT 1 cut(s) 266
Bme1390I CCNGG 2 cut(s) 10, 30
BmrFI CCNGG 2 cut(s) 10, 30
BpuEI CTTGAG 1 cut(s) 105
BsaJI CCNNGG 1 cut(s) 9
BseBI CCWGG 2 cut(s) 10, 30
BseDI CCNNGG 1 cut(s) 9
BseGI GGATG 1 cut(s) 114
BseRI GAGGAG 2 cut(s) 29, 32
BsgI GTGCAG 1 cut(s) 9
BshFI GGCC 1 cut(s) 8
BsnI GGCC 1 cut(s) 8
Bsp143I GATC 3 cut(s) 128, 145, 266
BspACI CCGC 1 cut(s) 46
BspANI GGCC 1 cut(s) 8
BspPI GGATC 1 cut(s) 140
BssECI CCNNGG 1 cut(s) 9
BssMI GATC 3 cut(s) 128, 145, 266
Bst2UI CCWGG 2 cut(s) 10, 30
BstDEI CTNAG 2 cut(s) 169, 215
BstF5I GGATG 1 cut(s) 114
BstKTI GATC 3 cut(s) 131, 148, 269
BstMBI GATC 3 cut(s) 128, 145, 266
BstMWI GCNNNNNNNGC 1 cut(s) 241
BstNI CCWGG 2 cut(s) 10, 30
BstSCI CCNGG 2 cut(s) 8, 28
BstX2I RGATCY 1 cut(s) 266
BstYI RGATCY 1 cut(s) 266
BsuRI GGCC 1 cut(s) 8
BtsCI GGATG 1 cut(s) 114
CviJI RGCY 4 cut(s) 8, 125, 180, 235
CviKI_1 RGCY 4 cut(s) 8, 125, 180, 235
DdeI CTNAG 2 cut(s) 169, 215
DpnI GATC 3 cut(s) 130, 147, 268
DpnII GATC 3 cut(s) 128, 145, 266
EciI GGCGGA 1 cut(s) 35
Eco57I CTGAAG 1 cut(s) 257
EcoRII CCWGG 2 cut(s) 8, 28
FaiI YATR 2 cut(s) 144, 156
FokI GGATG 1 cut(s) 121
FspBI CTAG 1 cut(s) 126
HaeIII GGCC 1 cut(s) 8
HincII GTYRAC 1 cut(s) 100
HindII GTYRAC 1 cut(s) 100
HinfI GANTC 1 cut(s) 286
Hpy166II GTNNAC 2 cut(s) 100, 185
Hpy188III TCNNGA 1 cut(s) 106
Hpy8I GTNNAC 2 cut(s) 100, 185
HpyAV CCTTC 1 cut(s) 170
HpyCH4V TGCA 2 cut(s) 26, 68
HpyF10VI GCNNNNNNNGC 1 cut(s) 241
HpyF3I CTNAG 2 cut(s) 169, 215
Kzo9I GATC 3 cut(s) 128, 145, 266
LpnPI CCDG 7 cut(s) 15, 22, 42, 78, 91, 108, 162
MaeI CTAG 1 cut(s) 126
MalI GATC 3 cut(s) 130, 147, 268
MboI GATC 3 cut(s) 128, 145, 266
MboII GAAGA 2 cut(s) 67, 250
MflI RGATCY 1 cut(s) 266
MluCI AATT 2 cut(s) 58, 90
MnlI CCTC 4 cut(s) 50, 53, 70, 113
MseI TTAA 1 cut(s) 198
MspR9I CCNGG 2 cut(s) 10, 30
MvaI CCWGG 2 cut(s) 10, 30
MwoI GCNNNNNNNGC 1 cut(s) 241
NdeII GATC 3 cut(s) 128, 145, 266
PfeI GAWTC 1 cut(s) 286
Psp6I CCWGG 2 cut(s) 8, 28
PspGI CCWGG 2 cut(s) 8, 28
PsuI RGATCY 1 cut(s) 266
SaqAI TTAA 1 cut(s) 198
Sau3AI GATC 3 cut(s) 128, 145, 266
ScrFI CCNGG 2 cut(s) 10, 30
SetI ASST 4 cut(s) 105, 127, 162, 237
SmlI CTYRAG 1 cut(s) 120
SmoI CTYRAG 1 cut(s) 120
Sse9I AATT 2 cut(s) 58, 90
SsiI CCGC 1 cut(s) 46
SspMI CTAG 1 cut(s) 126
StyD4I CCNGG 2 cut(s) 8, 28
TasI AATT 2 cut(s) 58, 90
TfiI GAWTC 1 cut(s) 286
Tru1I TTAA 1 cut(s) 198
Tru9I TTAA 1 cut(s) 198
TspDTI ATGAA 2 cut(s) 125, 278
XspI CTAG 1 cut(s) 126
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.