RchiOBHm_Chr7g0210771

Auxin-induced protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
OG0030528
Physical Location & Seq
Reverse (-)
28193365 .. 28193981
617 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ18860

Sequence Viewer

Length: 261 bp
ATGGGCTTCCGAATGCCTCGAGTTGCCAACATAAAGACAGCAGATATCCCAAAAGGCCACTTTGTGGTATATGTTGGAGTGTTGGACAGAGCCAGAAGAAACGATTTGTGGTTCCAATATCATATTTGTACCAACCTTTTGGTTCAGAATTTGCTGAGTCAAGCTGAAGAAGAATTCGGATACCATCATCCAATGGGTGGCATCACAATTCCTTGCAGTCAAGACACCTTCCTTGATGTCACTTCCCGCCTAAGTGTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04075 map04075
Pfam Domains
Protein Families
Auxin_inducible

Protein Analysis

86

Amino Acids

9.84

Weight (kDa)

6.89

Isoelectric Point (pI)

44.25

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Auxin_inducible PF02519 12 - 83 4.8e-13 Auxin responsive protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0030528)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr7g0210771 RchiOBHm_Chr7g0211161

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 2 cut(s) 64, 197
AciI CCGC 1 cut(s) 247
AcsI RAATTY 2 cut(s) 148, 173
AcuI CTGAAG 1 cut(s) 186
AdeI CACNNNGTG 1 cut(s) 64
AfaI GTAC 1 cut(s) 130
AfiI CCNNNNNNNGG 2 cut(s) 64, 197
AluBI AGCT 1 cut(s) 164
AluI AGCT 1 cut(s) 164
Ama87I CYCGRG 1 cut(s) 18
AoxI GGCC 1 cut(s) 55
ApoI RAATTY 2 cut(s) 148, 173
AvaI CYCGRG 1 cut(s) 18
BccI CCATC 1 cut(s) 192
BciVI GTATCC 1 cut(s) 173
BfuI GTATCC 1 cut(s) 173
BmeT110I CYCGRG 1 cut(s) 18
BmiI GGNNCC 1 cut(s) 113
BmsI GCATC 1 cut(s) 210
Bsc4I CCNNNNNNNGG 2 cut(s) 64, 197
BseGI GGATG 1 cut(s) 187
BseLI CCNNNNNNNGG 2 cut(s) 64, 197
BseMII CTCAG 1 cut(s) 146
BshFI GGCC 1 cut(s) 57
BsiHKCI CYCGRG 1 cut(s) 18
BslI CCNNNNNNNGG 2 cut(s) 64, 197
BsmI GAATGC 1 cut(s) 18
BsnI GGCC 1 cut(s) 57
BsoBI CYCGRG 1 cut(s) 18
BspACI CCGC 1 cut(s) 247
BspANI GGCC 1 cut(s) 57
BspCNI CTCAG 1 cut(s) 147
BspLI GGNNCC 1 cut(s) 113
BstDEI CTNAG 2 cut(s) 155, 251
BstF5I GGATG 1 cut(s) 187
BstXI CCANNNNNNTGG 1 cut(s) 139
BsuI GTATCC 1 cut(s) 173
BsuRI GGCC 1 cut(s) 57
BtsCI GGATG 1 cut(s) 187
Csp6I GTAC 1 cut(s) 129
CviJI RGCY 4 cut(s) 6, 57, 92, 164
CviKI_1 RGCY 4 cut(s) 6, 57, 92, 164
CviQI GTAC 1 cut(s) 129
DdeI CTNAG 2 cut(s) 155, 251
DraIII CACNNNGTG 1 cut(s) 64
Eco32I GATATC 1 cut(s) 46
Eco57I CTGAAG 1 cut(s) 186
Eco88I CYCGRG 1 cut(s) 18
EcoRI GAATTC 1 cut(s) 173
EcoRV GATATC 1 cut(s) 46
FaiI YATR 4 cut(s) 32, 70, 72, 123
FauI CCCGC 1 cut(s) 254
FokI GGATG 1 cut(s) 174
HaeIII GGCC 1 cut(s) 57
HinfI GANTC 1 cut(s) 157
Hpy188I TCNGA 3 cut(s) 11, 147, 179
Hpy188III TCNNGA 1 cut(s) 221
HpyAV CCTTC 1 cut(s) 238
HpyCH4V TGCA 1 cut(s) 216
HpyF3I CTNAG 2 cut(s) 155, 251
LpnPI CCDG 1 cut(s) 106
LweI GCATC 1 cut(s) 210
MaeIII GTNAC 1 cut(s) 238
MboII GAAGA 3 cut(s) 108, 179, 182
MluCI AATT 3 cut(s) 148, 173, 207
MlyI GAGTC 1 cut(s) 166
MmeI TCCRAC 2 cut(s) 55, 63
MnlI CCTC 1 cut(s) 27
Mva1269I GAATGC 1 cut(s) 18
NlaIV GGNNCC 1 cut(s) 113
NmuCI GTSAC 1 cut(s) 238
PaeR7I CTCGAG 1 cut(s) 18
PctI GAATGC 1 cut(s) 18
PflMI CCANNNNNTGG 2 cut(s) 64, 197
PleI GAGTC 1 cut(s) 165
PpsI GAGTC 1 cut(s) 165
PspN4I GGNNCC 1 cut(s) 113
PspXI VCTCGAGB 1 cut(s) 18
RsaI GTAC 1 cut(s) 130
RsaNI GTAC 1 cut(s) 129
SchI GAGTC 1 cut(s) 166
SetI ASST 3 cut(s) 138, 166, 230
SfaNI GCATC 1 cut(s) 210
Sfr274I CTCGAG 1 cut(s) 18
SgeI CNNG 7 cut(s) 30, 32, 105, 173, 225, 233, 245
SlaI CTCGAG 1 cut(s) 18
SmlI CTYRAG 1 cut(s) 18
SmoI CTYRAG 1 cut(s) 18
Sse9I AATT 3 cut(s) 148, 173, 207
SsiI CCGC 1 cut(s) 247
TaqI TCGA 1 cut(s) 19
TasI AATT 3 cut(s) 148, 173, 207
TseFI GTSAC 1 cut(s) 238
Tsp45I GTSAC 1 cut(s) 238
Van91I CCANNNNNTGG 2 cut(s) 64, 197
XapI RAATTY 2 cut(s) 148, 173
XhoI CTCGAG 1 cut(s) 18
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.