RchiOBHm_Chr7g0211161

Auxin-induced protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
OG0030528
Physical Location & Seq
Reverse (-)
28449423 .. 28449857
435 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ18891

Sequence Viewer

Length: 192 bp
ATGGGTTTTCAATTGCCTCGAATTGCTAGCACAAAGACACTAGATATCCCAAAAGGCTACTTTGCAGTCTATGTTGGAAATTTGCTGAGTCAAGCTGAAGAAGAATTTGGATACCATCATCCAATGGGTGGTATTACAATTCCTTGCAGTGAAGACACCTTCATTGATCTCACTTCCCGCTTAAGTGTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04075 map04075
Pfam Domains
Protein Families
Auxin_inducible

Protein Analysis

63

Amino Acids

6.96

Weight (kDa)

5.01

Isoelectric Point (pI)

24.72

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Auxin_inducible PF02519 27 - 60 9.4e-07 Auxin responsive protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0030528)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr7g0210771 RchiOBHm_Chr7g0211161

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 128
AciI CCGC 1 cut(s) 178
AcsI RAATTY 2 cut(s) 79, 104
AcuI CTGAAG 1 cut(s) 117
AfiI CCNNNNNNNGG 1 cut(s) 128
AflII CTTAAG 1 cut(s) 181
AgsI TTSAA 1 cut(s) 11
AjuI GAANNNNNNNTTGG 2 cut(s) 90, 122
AluBI AGCT 1 cut(s) 95
AluI AGCT 1 cut(s) 95
ApoI RAATTY 2 cut(s) 79, 104
AsuNHI GCTAGC 1 cut(s) 26
BbsI GAAGAC 1 cut(s) 159
BccI CCATC 1 cut(s) 123
BciVI GTATCC 1 cut(s) 104
BfaI CTAG 2 cut(s) 27, 41
BfrI CTTAAG 1 cut(s) 181
BfuI GTATCC 1 cut(s) 104
BmtI GCTAGC 1 cut(s) 30
BpiI GAAGAC 1 cut(s) 159
Bsc4I CCNNNNNNNGG 1 cut(s) 128
BseGI GGATG 1 cut(s) 118
BseLI CCNNNNNNNGG 1 cut(s) 128
BseMII CTCAG 1 cut(s) 77
BslI CCNNNNNNNGG 1 cut(s) 128
Bsp143I GATC 1 cut(s) 166
BspACI CCGC 1 cut(s) 178
BspCNI CTCAG 1 cut(s) 78
BspOI GCTAGC 1 cut(s) 30
BspTI CTTAAG 1 cut(s) 181
BssMI GATC 1 cut(s) 166
BstAFI CTTAAG 1 cut(s) 181
BstC8I GCNNGC 1 cut(s) 28
BstDEI CTNAG 1 cut(s) 86
BstF5I GGATG 1 cut(s) 118
BstKTI GATC 1 cut(s) 169
BstMBI GATC 1 cut(s) 166
BstV2I GAAGAC 1 cut(s) 159
BsuI GTATCC 1 cut(s) 104
BtsCI GGATG 1 cut(s) 118
BtsI GCAGTG 1 cut(s) 154
BtsIMutI CAGTG 1 cut(s) 154
Cac8I GCNNGC 1 cut(s) 28
CviJI RGCY 2 cut(s) 57, 95
CviKI_1 RGCY 2 cut(s) 57, 95
DdeI CTNAG 1 cut(s) 86
DpnI GATC 1 cut(s) 168
DpnII GATC 1 cut(s) 166
Eco32I GATATC 1 cut(s) 46
Eco57I CTGAAG 1 cut(s) 117
EcoRV GATATC 1 cut(s) 46
FaiI YATR 1 cut(s) 72
FauI CCCGC 1 cut(s) 185
FokI GGATG 1 cut(s) 105
FspBI CTAG 2 cut(s) 27, 41
HinfI GANTC 1 cut(s) 88
HpyAV CCTTC 1 cut(s) 169
HpyCH4V TGCA 2 cut(s) 65, 147
HpyF3I CTNAG 1 cut(s) 86
Kzo9I GATC 1 cut(s) 166
MaeI CTAG 2 cut(s) 27, 41
MalI GATC 1 cut(s) 168
MboI GATC 1 cut(s) 166
MboII GAAGA 3 cut(s) 110, 113, 164
MfeI CAATTG 1 cut(s) 11
MluCI AATT 5 cut(s) 11, 21, 79, 104, 138
MlyI GAGTC 1 cut(s) 97
MmeI TCCRAC 1 cut(s) 55
MnlI CCTC 1 cut(s) 27
MseI TTAA 1 cut(s) 182
MspCI CTTAAG 1 cut(s) 181
MunI CAATTG 1 cut(s) 11
NdeII GATC 1 cut(s) 166
NheI GCTAGC 1 cut(s) 26
PflMI CCANNNNNTGG 1 cut(s) 128
PleI GAGTC 1 cut(s) 96
PpsI GAGTC 1 cut(s) 96
SaqAI TTAA 1 cut(s) 182
Sau3AI GATC 1 cut(s) 166
SchI GAGTC 1 cut(s) 97
SetI ASST 2 cut(s) 97, 161
SgeI CNNG 5 cut(s) 30, 39, 53, 104, 156
SmlI CTYRAG 1 cut(s) 181
SmoI CTYRAG 1 cut(s) 181
Sse9I AATT 5 cut(s) 11, 21, 79, 104, 138
SsiI CCGC 1 cut(s) 178
SspMI CTAG 2 cut(s) 27, 41
TaqI TCGA 1 cut(s) 19
TasI AATT 5 cut(s) 11, 21, 79, 104, 138
Tru1I TTAA 1 cut(s) 182
Tru9I TTAA 1 cut(s) 182
TscAI CASTG 1 cut(s) 154
TspDTI ATGAA 1 cut(s) 151
TspRI CASTG 1 cut(s) 154
Van91I CCANNNNNTGG 1 cut(s) 128
Vha464I CTTAAG 1 cut(s) 181
XapI RAATTY 2 cut(s) 79, 104
XspI CTAG 2 cut(s) 27, 41
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.