RchiOBHm_Chr7g0214181
ERF Family

Belongs to the small GTPase superfamily. Arf family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
OG0025109
Physical Location & Seq
Forward (+)
31437108 .. 31437260
153 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ19167

Sequence Viewer

Length: 153 bp
ATGAAGGACGAACTCGTCAGGTTGCTTGGACATGCGGATCTTCAACATTCAGTCATACTGGTTTTTGCTAATAAACAAGATCTCAAGGATGCCATGATCCCAGCTGAGATCACTGACATTTTGTCTCTTCACAACATTAAGAATCATGACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Arf

Protein Analysis

50

Amino Acids

5.67

Weight (kDa)

5.66

Isoelectric Point (pI)

52.9

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Arf PF00025 1 - 49 9.3e-11 ADP-ribosylation factor family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0025109)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr7g0214181 RchiOBHm_Chr7g0214291
rosa_samantha Rh7CG298900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 14
AciI CCGC 1 cut(s) 35
AclWI GGATC 2 cut(s) 45, 91
AgsI TTSAA 1 cut(s) 44
AhdI GACNNNNNGTC 1 cut(s) 121
AluBI AGCT 1 cut(s) 104
AluI AGCT 1 cut(s) 104
Alw26I GTCTC 1 cut(s) 129
AlwI GGATC 2 cut(s) 45, 91
BcoDI GTCTC 1 cut(s) 129
BfaI CTAG 1 cut(s) 151
BglII AGATCT 1 cut(s) 79
BmeRI GACNNNNNGTC 1 cut(s) 121
BmsI GCATC 1 cut(s) 79
BpuEI CTTGAG 1 cut(s) 68
Bse1I ACTGG 1 cut(s) 63
BseGI GGATG 1 cut(s) 94
BseMII CTCAG 1 cut(s) 96
BseNI ACTGG 1 cut(s) 63
BseYI CCCAGC 1 cut(s) 100
BsmAI GTCTC 1 cut(s) 129
Bsp143I GATC 4 cut(s) 37, 79, 96, 108
BspACI CCGC 1 cut(s) 35
BspCNI CTCAG 1 cut(s) 97
BspHI TCATGA 1 cut(s) 145
BspPI GGATC 2 cut(s) 45, 91
BsrI ACTGG 1 cut(s) 63
BssMI GATC 4 cut(s) 37, 79, 96, 108
Bst6I CTCTTC 1 cut(s) 132
BstDEI CTNAG 1 cut(s) 105
BstF5I GGATG 1 cut(s) 94
BstKTI GATC 4 cut(s) 40, 82, 99, 111
BstMAI GTCTC 1 cut(s) 129
BstMBI GATC 4 cut(s) 37, 79, 96, 108
BstNSI RCATGY 1 cut(s) 35
BstX2I RGATCY 2 cut(s) 37, 79
BstYI RGATCY 2 cut(s) 37, 79
BtsCI GGATG 1 cut(s) 94
BtsIMutI CAGTG 1 cut(s) 111
CciI TCATGA 1 cut(s) 145
CviAII CATG 3 cut(s) 32, 94, 146
CviJI RGCY 1 cut(s) 104
CviKI_1 RGCY 1 cut(s) 104
DdeI CTNAG 1 cut(s) 105
DpnI GATC 4 cut(s) 39, 81, 98, 110
DpnII GATC 4 cut(s) 37, 79, 96, 108
DrdI GACNNNNNNGTC 1 cut(s) 14
DriI GACNNNNNGTC 1 cut(s) 121
DseDI GACNNNNNNGTC 1 cut(s) 14
Eam1104I CTCTTC 1 cut(s) 132
Eam1105I GACNNNNNGTC 1 cut(s) 121
EarI CTCTTC 1 cut(s) 132
FaeI CATG 3 cut(s) 35, 97, 149
FaiI YATR 4 cut(s) 33, 56, 95, 147
FatI CATG 3 cut(s) 31, 93, 145
FokI GGATG 1 cut(s) 101
FspBI CTAG 1 cut(s) 151
FspEI CC 8 cut(s) 4, 12, 20, 44, 71, 106, 113, 114
GsaI CCCAGC 1 cut(s) 104
Hin1II CATG 3 cut(s) 35, 97, 149
HinfI GANTC 1 cut(s) 142
Hpy188III TCNNGA 1 cut(s) 146
HpyF3I CTNAG 1 cut(s) 105
Hsp92II CATG 3 cut(s) 35, 97, 149
Kzo9I GATC 4 cut(s) 37, 79, 96, 108
LpnPI CCDG 3 cut(s) 4, 44, 114
LweI GCATC 1 cut(s) 79
MaeI CTAG 1 cut(s) 151
MalI GATC 4 cut(s) 39, 81, 98, 110
MboI GATC 4 cut(s) 37, 79, 96, 108
MboII GAAGA 2 cut(s) 32, 119
MflI RGATCY 2 cut(s) 37, 79
MseI TTAA 1 cut(s) 138
MspA1I CMGCKG 1 cut(s) 104
NdeII GATC 4 cut(s) 37, 79, 96, 108
NlaIII CATG 3 cut(s) 35, 97, 149
NspI RCATGY 1 cut(s) 35
PagI TCATGA 1 cut(s) 145
PfeI GAWTC 1 cut(s) 142
PspFI CCCAGC 1 cut(s) 100
PsuI RGATCY 2 cut(s) 37, 79
PvuII CAGCTG 1 cut(s) 104
SaqAI TTAA 1 cut(s) 138
Sau3AI GATC 4 cut(s) 37, 79, 96, 108
SetI ASST 2 cut(s) 23, 106
SfaNI GCATC 1 cut(s) 79
SgeI CNNG 9 cut(s) 26, 31, 38, 44, 71, 89, 97, 106, 113
SmlI CTYRAG 1 cut(s) 83
SmoI CTYRAG 1 cut(s) 83
SsiI CCGC 1 cut(s) 35
SspMI CTAG 1 cut(s) 151
TfiI GAWTC 1 cut(s) 142
Tru1I TTAA 1 cut(s) 138
Tru9I TTAA 1 cut(s) 138
TscAI CASTG 1 cut(s) 118
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 1 cut(s) 118
XceI RCATGY 1 cut(s) 35
XspI CTAG 1 cut(s) 151
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.