Rh7CG298900
ERF Family

Belongs to the small GTPase superfamily. Arf family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
OG0025109
Physical Location & Seq
Forward (+)
30817989 .. 30818150
162 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG298900.1

Sequence Viewer

Length: 162 bp
ATGAAGGACGAACTCTTCAGGTTGCTTGGACATGCGGATCTTCAACATTCAGTCATACTGGTTTTTGCTAATAAACAAGATCTCAAGGATGCCATGATCCCAGCTGAGATAAGTCAGATCACTGACACTCTGTCTCTTCACAACATTAAGAATCATGACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Arf

Protein Analysis

53

Amino Acids

6.04

Weight (kDa)

5.66

Isoelectric Point (pI)

47.63

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Arf PF00025 1 - 52 1e-08 ADP-ribosylation factor family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0025109)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr7g0214181 RchiOBHm_Chr7g0214291
rosa_samantha Rh7CG298900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 35
AclWI GGATC 2 cut(s) 45, 91
AgsI TTSAA 1 cut(s) 44
AhdI GACNNNNNGTC 1 cut(s) 130
AluBI AGCT 1 cut(s) 104
AluI AGCT 1 cut(s) 104
Alw26I GTCTC 1 cut(s) 138
AlwI GGATC 2 cut(s) 45, 91
BcoDI GTCTC 1 cut(s) 138
BfaI CTAG 1 cut(s) 160
BglII AGATCT 1 cut(s) 79
BmeRI GACNNNNNGTC 1 cut(s) 130
BmsI GCATC 1 cut(s) 79
BpuEI CTTGAG 1 cut(s) 68
Bse1I ACTGG 1 cut(s) 63
BseGI GGATG 1 cut(s) 94
BseMII CTCAG 1 cut(s) 96
BseNI ACTGG 1 cut(s) 63
BseYI CCCAGC 1 cut(s) 100
BsmAI GTCTC 1 cut(s) 138
Bsp143I GATC 4 cut(s) 37, 79, 96, 117
BspACI CCGC 1 cut(s) 35
BspCNI CTCAG 1 cut(s) 97
BspHI TCATGA 1 cut(s) 154
BspPI GGATC 2 cut(s) 45, 91
BsrI ACTGG 1 cut(s) 63
BssMI GATC 4 cut(s) 37, 79, 96, 117
Bst6I CTCTTC 2 cut(s) 20, 141
BstDEI CTNAG 1 cut(s) 105
BstF5I GGATG 1 cut(s) 94
BstKTI GATC 4 cut(s) 40, 82, 99, 120
BstMAI GTCTC 1 cut(s) 138
BstMBI GATC 4 cut(s) 37, 79, 96, 117
BstNSI RCATGY 1 cut(s) 35
BstX2I RGATCY 2 cut(s) 37, 79
BstYI RGATCY 2 cut(s) 37, 79
BtsCI GGATG 1 cut(s) 94
BtsIMutI CAGTG 1 cut(s) 120
CciI TCATGA 1 cut(s) 154
CviAII CATG 3 cut(s) 32, 94, 155
CviJI RGCY 1 cut(s) 104
CviKI_1 RGCY 1 cut(s) 104
DdeI CTNAG 1 cut(s) 105
DpnI GATC 4 cut(s) 39, 81, 98, 119
DpnII GATC 4 cut(s) 37, 79, 96, 117
DriI GACNNNNNGTC 1 cut(s) 130
Eam1104I CTCTTC 2 cut(s) 20, 141
Eam1105I GACNNNNNGTC 1 cut(s) 130
EarI CTCTTC 2 cut(s) 20, 141
FaeI CATG 3 cut(s) 35, 97, 158
FaiI YATR 4 cut(s) 33, 56, 95, 156
FatI CATG 3 cut(s) 31, 93, 154
FokI GGATG 1 cut(s) 101
FspBI CTAG 1 cut(s) 160
FspEI CC 8 cut(s) 4, 12, 20, 44, 71, 106, 113, 114
GsaI CCCAGC 1 cut(s) 104
Hin1II CATG 3 cut(s) 35, 97, 158
HinfI GANTC 1 cut(s) 151
Hpy188I TCNGA 1 cut(s) 117
Hpy188III TCNNGA 1 cut(s) 155
HpyF3I CTNAG 1 cut(s) 105
Hsp92II CATG 3 cut(s) 35, 97, 158
Kzo9I GATC 4 cut(s) 37, 79, 96, 117
LpnPI CCDG 3 cut(s) 4, 44, 114
LweI GCATC 1 cut(s) 79
MaeI CTAG 1 cut(s) 160
MalI GATC 4 cut(s) 39, 81, 98, 119
MboI GATC 4 cut(s) 37, 79, 96, 117
MboII GAAGA 3 cut(s) 7, 32, 128
MflI RGATCY 2 cut(s) 37, 79
MseI TTAA 1 cut(s) 147
MspA1I CMGCKG 1 cut(s) 104
NdeII GATC 4 cut(s) 37, 79, 96, 117
NlaIII CATG 3 cut(s) 35, 97, 158
NspI RCATGY 1 cut(s) 35
PagI TCATGA 1 cut(s) 154
PfeI GAWTC 1 cut(s) 151
PspFI CCCAGC 1 cut(s) 100
PsuI RGATCY 2 cut(s) 37, 79
PvuII CAGCTG 1 cut(s) 104
SaqAI TTAA 1 cut(s) 147
Sau3AI GATC 4 cut(s) 37, 79, 96, 117
SetI ASST 2 cut(s) 23, 106
SfaNI GCATC 1 cut(s) 79
SgeI CNNG 8 cut(s) 31, 38, 44, 71, 89, 97, 106, 113
SmlI CTYRAG 1 cut(s) 83
SmoI CTYRAG 1 cut(s) 83
SsiI CCGC 1 cut(s) 35
SspMI CTAG 1 cut(s) 160
TfiI GAWTC 1 cut(s) 151
Tru1I TTAA 1 cut(s) 147
Tru9I TTAA 1 cut(s) 147
TscAI CASTG 1 cut(s) 127
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 1 cut(s) 127
XceI RCATGY 1 cut(s) 35
XspI CTAG 1 cut(s) 160
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.