Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0030436

Physical Location & Seq

Genomic Coordinates Reverse (-)

57506694 .. 57506861

Gene Structure 168 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ20895

Sequence Viewer

CDS Protein Promoter (2k)

Length: 168 bp

ATGATAAGTATGCCTGCCGGGAAGCCAATCATTGTGAAGAAGAATTTAAGGGTGTGCTTGGATTGCCATTCTGCAATCAAGTACATCTCCTTGGTTGTTGGAAGAAAGATTATAGTTAGGGACAATACTCGGTTCCACCATTTCGCAGATGGGTTGTGTTCATGTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DYW_deaminase PPR PPR_2

Protein Analysis

55

Amino Acids

6.17

Weight (kDa)

9.62

Isoelectric Point (pI)

24.04

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
DYW_deaminase	PF14432	2 - 55	8.3e-23	DYW family of nucleic acid deaminases

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0030436)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr7g0233131
rosa_laevigata	RLG00000001294

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	1 cut(s)	43
AfaI	GTAC	1 cut(s)	83
ApoI	RAATTY	1 cut(s)	43
AsuC2I	CCSGG	1 cut(s)	19
BccI	CCATC	1 cut(s)	143
BcnI	CCSGG	1 cut(s)	19
Bme1390I	CCNGG	1 cut(s)	19
BmiI	GGNNCC	1 cut(s)	134
BmrFI	CCNGG	1 cut(s)	19
BpuMI	CCSGG	1 cut(s)	19
BsaJI	CCNNGG	1 cut(s)	90
BseDI	CCNNGG	1 cut(s)	90
BsiSI	CCGG	1 cut(s)	18
BslFI	GGGAC	1 cut(s)	134
BsmFI	GGGAC	1 cut(s)	134
BspLI	GGNNCC	1 cut(s)	134
BssECI	CCNNGG	1 cut(s)	90
BssT1I	CCWWGG	1 cut(s)	90
BstC8I	GCNNGC	1 cut(s)	15
BstMWI	GCNNNNNNNGC	1 cut(s)	63
BstSCI	CCNGG	1 cut(s)	17
Cac8I	GCNNGC	1 cut(s)	15
Csp6I	GTAC	1 cut(s)	82
CviAII	CATG	1 cut(s)	162
CviJI	RGCY	1 cut(s)	25
CviKI_1	RGCY	1 cut(s)	25
CviQI	GTAC	1 cut(s)	82
Eco130I	CCWWGG	1 cut(s)	90
EcoT14I	CCWWGG	1 cut(s)	90
ErhI	CCWWGG	1 cut(s)	90
FaeI	CATG	1 cut(s)	165
FaiI	YATR	3 cut(s)	11, 113, 163
FaqI	GGGAC	1 cut(s)	134
FatI	CATG	1 cut(s)	161
HapII	CCGG	1 cut(s)	18
Hin1II	CATG	1 cut(s)	165
HpaII	CCGG	1 cut(s)	18
HpyCH4V	TGCA	1 cut(s)	74
HpyF10VI	GCNNNNNNNGC	1 cut(s)	63
Hsp92II	CATG	1 cut(s)	165
LpnPI	CCDG	2 cut(s)	27, 31
MboII	GAAGA	3 cut(s)	49, 52, 114
MluCI	AATT	1 cut(s)	43
MmeI	TCCRAC	1 cut(s)	79
MseI	TTAA	1 cut(s)	47
MspI	CCGG	1 cut(s)	18
MspR9I	CCNGG	1 cut(s)	19
MwoI	GCNNNNNNNGC	1 cut(s)	63
NciI	CCSGG	1 cut(s)	19
NlaIII	CATG	1 cut(s)	165
NlaIV	GGNNCC	1 cut(s)	134
PspN4I	GGNNCC	1 cut(s)	134
RsaI	GTAC	1 cut(s)	83
RsaNI	GTAC	1 cut(s)	82
SaqAI	TTAA	1 cut(s)	47
ScrFI	CCNGG	1 cut(s)	19
SgeI	CNNG	7 cut(s)	26, 30, 31, 70, 91, 103, 141
Sse9I	AATT	1 cut(s)	43
StyD4I	CCNGG	1 cut(s)	17
StyI	CCWWGG	1 cut(s)	90
TasI	AATT	1 cut(s)	43
TatI	WGTACW	1 cut(s)	81
Tru1I	TTAA	1 cut(s)	47
Tru9I	TTAA	1 cut(s)	47
TspDTI	ATGAA	1 cut(s)	150
XapI	RAATTY	1 cut(s)	43
XcmI	CCANNNNNNNNNTGG	1 cut(s)	146

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.