RchiOBHm_Chr7g0233421

Oligopeptidase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
OG0030484
Physical Location & Seq
Forward (+)
57817806 .. 57818810
1005 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ20923

Sequence Viewer

Length: 279 bp
ATGGATGCACTATTCCACTTATTATATGTGTTGTTTGAAATTCATATTGCATCGACCGATGACACAGCTCTAGTACAAACTATTTTCCATGAATTTGGACATGCATTTCAGCTTGTATTGACAAAGCAAGATGAATTGCTAGTGGCTAATTTTCAAAATATAGAGAAAGATTGTATTGATGTACCCTCCACATTCCTAGACAAATGGTGTTACCATGGTTTACAGGTAAATTCTCTTCACAAATCTTTTAAACTATATTATGCATCTAAATCTTCTTGA

Protein Analysis

92

Amino Acids

10.65

Weight (kDa)

5.51

Isoelectric Point (pI)

42.62

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Peptidase_M3 PF01432 25 - 82 1.5e-10 Peptidase family M3
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0030484)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr7g0233421
rosa_samantha Rh7BG409200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 3 cut(s) 39, 92, 229
AfaI GTAC 2 cut(s) 75, 183
AgsI TTSAA 2 cut(s) 38, 155
AluBI AGCT 2 cut(s) 68, 112
AluI AGCT 2 cut(s) 68, 112
ApoI RAATTY 3 cut(s) 39, 92, 229
BarI GAAGNNNNNNTAC 2 cut(s) 219, 251
BfaI CTAG 3 cut(s) 71, 140, 197
BmsI GCATC 2 cut(s) 59, 272
BsaJI CCNNGG 1 cut(s) 214
BseDI CCNNGG 1 cut(s) 214
BseGI GGATG 1 cut(s) 10
Bsh1285I CGRYCG 1 cut(s) 57
BsiEI CGRYCG 1 cut(s) 57
Bsp19I CCATGG 1 cut(s) 214
BssECI CCNNGG 1 cut(s) 214
BssT1I CCWWGG 1 cut(s) 214
Bst6I CTCTTC 1 cut(s) 240
BstDSI CCRYGG 1 cut(s) 214
BstF5I GGATG 1 cut(s) 10
BstMCI CGRYCG 1 cut(s) 57
BstNSI RCATGY 1 cut(s) 104
BstXI CCANNNNNNTGG 1 cut(s) 95
BtgI CCRYGG 1 cut(s) 214
BtsCI GGATG 1 cut(s) 10
Csp6I GTAC 2 cut(s) 74, 182
CviAII CATG 3 cut(s) 89, 101, 215
CviJI RGCY 3 cut(s) 68, 112, 146
CviKI_1 RGCY 3 cut(s) 68, 112, 146
CviQI GTAC 2 cut(s) 74, 182
DraI TTTAAA 1 cut(s) 250
Eam1104I CTCTTC 1 cut(s) 240
EarI CTCTTC 1 cut(s) 240
Eco130I CCWWGG 1 cut(s) 214
EcoT14I CCWWGG 1 cut(s) 214
EcoT22I ATGCAT 2 cut(s) 106, 265
ErhI CCWWGG 1 cut(s) 214
FaeI CATG 3 cut(s) 92, 104, 218
FaiI YATR 9 cut(s) 25, 27, 45, 90, 102, 161, 216, 256, 261
FatI CATG 3 cut(s) 88, 100, 214
FokI GGATG 1 cut(s) 17
FspBI CTAG 3 cut(s) 71, 140, 197
Hin1II CATG 3 cut(s) 92, 104, 218
Hpy166II GTNNAC 1 cut(s) 221
Hpy188III TCNNGA 1 cut(s) 276
Hpy8I GTNNAC 1 cut(s) 221
HpyCH4V TGCA 4 cut(s) 8, 50, 104, 263
Hsp92II CATG 3 cut(s) 92, 104, 218
LpnPI CCDG 1 cut(s) 209
LweI GCATC 2 cut(s) 59, 272
MaeI CTAG 3 cut(s) 71, 140, 197
MaeIII GTNAC 1 cut(s) 209
MboII GAAGA 2 cut(s) 227, 264
MluCI AATT 5 cut(s) 39, 92, 134, 148, 229
MnlI CCTC 1 cut(s) 196
Mph1103I ATGCAT 2 cut(s) 106, 265
MseI TTAA 1 cut(s) 249
NcoI CCATGG 1 cut(s) 214
NlaIII CATG 3 cut(s) 92, 104, 218
NsiI ATGCAT 2 cut(s) 106, 265
NspI RCATGY 1 cut(s) 104
RsaI GTAC 2 cut(s) 75, 183
RsaNI GTAC 2 cut(s) 74, 182
SaqAI TTAA 1 cut(s) 249
SetI ASST 3 cut(s) 70, 114, 228
SfaNI GCATC 2 cut(s) 59, 272
SgeI CNNG 9 cut(s) 83, 101, 113, 125, 140, 152, 209, 227, 236
Sse9I AATT 5 cut(s) 39, 92, 134, 148, 229
SspMI CTAG 3 cut(s) 71, 140, 197
StyI CCWWGG 1 cut(s) 214
TaqI TCGA 1 cut(s) 53
TaqII GACCGA 1 cut(s) 71
TasI AATT 5 cut(s) 39, 92, 134, 148, 229
TatI WGTACW 1 cut(s) 73
Tru1I TTAA 1 cut(s) 249
Tru9I TTAA 1 cut(s) 249
TspDTI ATGAA 3 cut(s) 32, 105, 147
XapI RAATTY 3 cut(s) 39, 92, 229
XceI RCATGY 1 cut(s) 104
XspI CTAG 3 cut(s) 71, 140, 197
Zsp2I ATGCAT 2 cut(s) 106, 265
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.