RchiOBHm_Chr7g0234281

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Reverse (-)
58918470 .. 58919019
550 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ20996

Sequence Viewer

Length: 150 bp
ATGCGTAGATGGTTATTAGTCTTACTGCTACCTCTGAATTCCAATAGAAAGAGCTCTGTGCTTAGTCTTCCGTTCTTTGTTAAATGTTTTGTAGAGTGCTCAGGCTTTGGAGAGGTAAATGTTTTGTATAGTGCTCAAGCTTCAGAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

49

Amino Acids

5.55

Weight (kDa)

8.84

Isoelectric Point (pI)

60.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0030501)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr7g0234281
rosa_roxburghii Rroxscaffold_3G00226820

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 37
AcuI CTGAAG 1 cut(s) 126
AluBI AGCT 2 cut(s) 54, 140
AluI AGCT 2 cut(s) 54, 140
Alw21I GWGCWC 3 cut(s) 56, 101, 136
ApoI RAATTY 1 cut(s) 37
BanII GRGCYC 1 cut(s) 56
BbsI GAAGAC 1 cut(s) 59
Bbv12I GWGCWC 3 cut(s) 56, 101, 136
BccI CCATC 1 cut(s) 3
BpiI GAAGAC 1 cut(s) 59
Bpu10I CCTNAGC 1 cut(s) 100
BpuEI CTTGAG 1 cut(s) 120
BseMII CTCAG 1 cut(s) 114
BsiHKAI GWGCWC 3 cut(s) 56, 101, 136
Bsp1286I GDGCHC 3 cut(s) 56, 101, 136
BspCNI CTCAG 1 cut(s) 113
BstDEI CTNAG 2 cut(s) 62, 100
BstV2I GAAGAC 1 cut(s) 59
CviJI RGCY 3 cut(s) 54, 105, 140
CviKI_1 RGCY 3 cut(s) 54, 105, 140
DdeI CTNAG 2 cut(s) 62, 100
Ecl136II GAGCTC 1 cut(s) 54
Eco24I GRGCYC 1 cut(s) 56
Eco53kI GAGCTC 1 cut(s) 54
Eco57I CTGAAG 1 cut(s) 126
EcoICRI GAGCTC 1 cut(s) 54
EcoRI GAATTC 1 cut(s) 37
EcoT38I GRGCYC 1 cut(s) 56
FaiI YATR 1 cut(s) 129
FriOI GRGCYC 1 cut(s) 56
FspEI CC 6 cut(s) 45, 55, 84, 87, 93, 98
HindIII AAGCTT 1 cut(s) 138
Hpy188I TCNGA 2 cut(s) 36, 145
HpyF3I CTNAG 2 cut(s) 62, 100
LpnPI CCDG 1 cut(s) 87
MboII GAAGA 1 cut(s) 59
MhlI GDGCHC 3 cut(s) 56, 101, 136
MluCI AATT 1 cut(s) 37
MnlI CCTC 2 cut(s) 42, 106
MseI TTAA 1 cut(s) 81
Psp124BI GAGCTC 1 cut(s) 56
SacI GAGCTC 1 cut(s) 56
SaqAI TTAA 1 cut(s) 81
SduI GDGCHC 3 cut(s) 56, 101, 136
SetI ASST 4 cut(s) 34, 56, 117, 142
SgeI CNNG 1 cut(s) 114
SmlI CTYRAG 1 cut(s) 135
SmoI CTYRAG 1 cut(s) 135
Sse9I AATT 1 cut(s) 37
SstI GAGCTC 1 cut(s) 56
TasI AATT 1 cut(s) 37
Tru1I TTAA 1 cut(s) 81
Tru9I TTAA 1 cut(s) 81
TspGWI ACGGA 1 cut(s) 60
XapI RAATTY 1 cut(s) 37
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.