RchiOBHm_Chr7g0243561

Belongs to the IPP transferase family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Reverse (-)
69815905 .. 69816334
430 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ21828

Sequence Viewer

Length: 273 bp
ATGGTGTCAGGAACTGATGGTATCTTGTCTGAGGCTAGATGGCTTCTTGATGCGGATCTTATTCCAAATTCCAATTCAGCAACCAGAGCAATTGGTTACAGAAACTTTATTATTATTCAAACAATCATTCTTGATTTTTTTTTCATTAGAATCTTATGCACTTTGTTATATCATGTTATGGAGTATTTGTTAGTGTGTAGGGAGCAAGGAGGTAGTTCTTCACCAAGAGAGTTCTACAACTTTTTGACTGAATTTCAAAAGGCATCTAGGTAA

Protein Analysis

90

Amino Acids

10.37

Weight (kDa)

5.68

Isoelectric Point (pI)

42.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022579)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 53
AclWI GGATC 1 cut(s) 63
AcsI RAATTY 2 cut(s) 67, 251
AgsI TTSAA 2 cut(s) 119, 257
AjuI GAANNNNNNNTTGG 2 cut(s) 58, 90
AlwI GGATC 1 cut(s) 63
AlwNI CAGNNNCTG 1 cut(s) 14
ApoI RAATTY 2 cut(s) 67, 251
AsuHPI GGTGA 1 cut(s) 213
BccI CCATC 2 cut(s) 11, 33
BfaI CTAG 2 cut(s) 36, 267
BmsI GCATC 1 cut(s) 40
BsaBI GATNNNNATC 1 cut(s) 54
BsaXI ACNNNNNCTCC 2 cut(s) 173, 203
Bse8I GATNNNNATC 1 cut(s) 54
BseJI GATNNNNATC 1 cut(s) 54
BseMII CTCAG 1 cut(s) 21
Bsp143I GATC 1 cut(s) 55
BspACI CCGC 1 cut(s) 53
BspCNI CTCAG 1 cut(s) 22
BspPI GGATC 1 cut(s) 63
BssMI GATC 1 cut(s) 55
BstDEI CTNAG 1 cut(s) 30
BstKTI GATC 1 cut(s) 58
BstMBI GATC 1 cut(s) 55
BstMWI GCNNNNNNNGC 1 cut(s) 86
BstX2I RGATCY 1 cut(s) 55
BstYI RGATCY 1 cut(s) 55
CaiI CAGNNNCTG 1 cut(s) 14
CviAII CATG 1 cut(s) 173
CviJI RGCY 2 cut(s) 35, 43
CviKI_1 RGCY 2 cut(s) 35, 43
DdeI CTNAG 1 cut(s) 30
DpnI GATC 1 cut(s) 57
DpnII GATC 1 cut(s) 55
FaeI CATG 1 cut(s) 176
FaiI YATR 4 cut(s) 157, 169, 174, 179
FatI CATG 1 cut(s) 172
FspBI CTAG 2 cut(s) 36, 267
Hin1II CATG 1 cut(s) 176
HinfI GANTC 1 cut(s) 150
HphI GGTGA 1 cut(s) 213
Hpy188I TCNGA 1 cut(s) 31
Hpy188III TCNNGA 3 cut(s) 9, 47, 131
HpyCH4V TGCA 1 cut(s) 159
HpyF10VI GCNNNNNNNGC 1 cut(s) 86
HpyF3I CTNAG 1 cut(s) 30
Hsp92II CATG 1 cut(s) 176
Kzo9I GATC 1 cut(s) 55
LmnI GCTCC 1 cut(s) 202
LpnPI CCDG 1 cut(s) 97
LweI GCATC 1 cut(s) 40
MaeI CTAG 2 cut(s) 36, 267
MaeIII GTNAC 1 cut(s) 95
MalI GATC 1 cut(s) 57
MboI GATC 1 cut(s) 55
MboII GAAGA 1 cut(s) 210
MfeI CAATTG 1 cut(s) 90
MflI RGATCY 1 cut(s) 55
MluCI AATT 4 cut(s) 67, 73, 90, 251
MnlI CCTC 2 cut(s) 25, 203
MunI CAATTG 1 cut(s) 90
MwoI GCNNNNNNNGC 1 cut(s) 86
NdeII GATC 1 cut(s) 55
NlaIII CATG 1 cut(s) 176
PfeI GAWTC 1 cut(s) 150
PstNI CAGNNNCTG 1 cut(s) 14
PsuI RGATCY 1 cut(s) 55
Sau3AI GATC 1 cut(s) 55
SetI ASST 2 cut(s) 214, 272
SfaNI GCATC 1 cut(s) 40
SgeI CNNG 9 cut(s) 21, 37, 48, 59, 96, 143, 185, 218, 237
Sse9I AATT 4 cut(s) 67, 73, 90, 251
SsiI CCGC 1 cut(s) 53
SspMI CTAG 2 cut(s) 36, 267
TasI AATT 4 cut(s) 67, 73, 90, 251
TfiI GAWTC 1 cut(s) 150
TspDTI ATGAA 1 cut(s) 133
XapI RAATTY 2 cut(s) 67, 251
XspI CTAG 2 cut(s) 36, 267
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.