RLG00000029249

Belongs to the UDP-glycosyltransferase family

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr6
Physical Location & Seq
Reverse (-)
35410276 .. 35410769
494 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000029249

Sequence Viewer

Length: 354 bp
ATGAAGTTTTCGGCTATTTCCAAAGGCACTGATGCTTATGTCGAGTTATTTGCAGACTCTTCTTCTCCCATATCACAGCTTATCAAGATCATAAACCTCCCACATGTCAATATGGACCATACGGAAGGCAGTGTCCGCAATAGCTTGATCGGACCTTTACTTAACCTTAACACTAATGAAAGTCGTGTGGATTCCGATGAGGCCAAGCAGAAGTATGATATCTTGAAATGGCTAAATGATCAGCCTCTTTTGTCTGTAGTGTTCTTGTGCTTTGGAAGCATGGGAAGCTTTGGTGCTAGAGGACCAGGTGAAAGAGATCGCCCACGCCCACGCCCTGGAGAATGCGGGCCATAG

Protein Analysis

118

Amino Acids

12.86

Weight (kDa)

6.07

Isoelectric Point (pI)

33.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029608)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0339931
rosa_laevigata RLG00000029249

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 335
AciI CCGC 2 cut(s) 136, 345
AfiI CCNNNNNNNGG 1 cut(s) 335
AflIII ACRYGT 1 cut(s) 103
AgsI TTSAA 1 cut(s) 226
AjnI CCWGG 2 cut(s) 304, 334
AluBI AGCT 3 cut(s) 79, 144, 288
AluI AGCT 3 cut(s) 79, 144, 288
AoxI GGCC 2 cut(s) 201, 347
AspS9I GGNCC 4 cut(s) 115, 152, 302, 347
AsuHPI GGTGA 1 cut(s) 320
AvaII GGWCC 3 cut(s) 115, 152, 302
BcgI CGANNNNNNTGC 2 cut(s) 32, 66
BciT130I CCWGG 2 cut(s) 306, 336
BclI TGATCA 1 cut(s) 238
BfaI CTAG 1 cut(s) 297
BfmI CTRYAG 1 cut(s) 255
Bme1390I CCNGG 2 cut(s) 306, 336
Bme18I GGWCC 3 cut(s) 115, 152, 302
BmgT120I GGNCC 4 cut(s) 115, 152, 302, 347
BmrFI CCNGG 2 cut(s) 306, 336
BmsI GCATC 1 cut(s) 22
BsaJI CCNNGG 1 cut(s) 334
Bsc4I CCNNNNNNNGG 1 cut(s) 335
BseBI CCWGG 2 cut(s) 306, 336
BseDI CCNNGG 1 cut(s) 334
BseLI CCNNNNNNNGG 1 cut(s) 335
BshFI GGCC 2 cut(s) 203, 349
BslI CCNNNNNNNGG 1 cut(s) 335
BsmI GAATGC 1 cut(s) 347
BsnI GGCC 2 cut(s) 203, 349
Bsp143I GATC 4 cut(s) 87, 147, 238, 316
BspACI CCGC 2 cut(s) 136, 345
BspANI GGCC 2 cut(s) 203, 349
BssECI CCNNGG 1 cut(s) 334
BssMI GATC 4 cut(s) 87, 147, 238, 316
Bst2UI CCWGG 2 cut(s) 306, 336
Bst6I CTCTTC 1 cut(s) 64
BstC8I GCNNGC 1 cut(s) 347
BstKTI GATC 4 cut(s) 90, 150, 241, 319
BstMBI GATC 4 cut(s) 87, 147, 238, 316
BstMWI GCNNNNNNNGC 3 cut(s) 135, 276, 285
BstNI CCWGG 2 cut(s) 306, 336
BstNSI RCATGY 1 cut(s) 107
BstSCI CCNGG 2 cut(s) 304, 334
BstSFI CTRYAG 1 cut(s) 255
BsuRI GGCC 2 cut(s) 203, 349
BtsI GCAGTG 1 cut(s) 136
BtsIMutI CAGTG 2 cut(s) 27, 136
Cac8I GCNNGC 1 cut(s) 347
Cfr13I GGNCC 4 cut(s) 115, 152, 302, 347
CsiI ACCWGGT 1 cut(s) 304
CviAII CATG 2 cut(s) 104, 280
CviJI RGCY 8 cut(s) 14, 79, 144, 203, 232, 244, 288, 349
CviKI_1 RGCY 8 cut(s) 14, 79, 144, 203, 232, 244, 288, 349
DpnI GATC 4 cut(s) 89, 149, 240, 318
DpnII GATC 4 cut(s) 87, 147, 238, 316
Eam1104I CTCTTC 1 cut(s) 64
EarI CTCTTC 1 cut(s) 64
Eco32I GATATC 1 cut(s) 220
Eco47I GGWCC 3 cut(s) 115, 152, 302
EcoRII CCWGG 2 cut(s) 304, 334
EcoRV GATATC 1 cut(s) 220
FaeI CATG 2 cut(s) 107, 283
FaiI YATR 9 cut(s) 39, 71, 92, 105, 113, 120, 216, 281, 352
FatI CATG 2 cut(s) 103, 279
FauI CCCGC 1 cut(s) 338
FbaI TGATCA 1 cut(s) 238
FspBI CTAG 1 cut(s) 297
HaeIII GGCC 2 cut(s) 203, 349
Hin1II CATG 2 cut(s) 107, 283
HindIII AAGCTT 1 cut(s) 286
HinfI GANTC 2 cut(s) 56, 191
HphI GGTGA 1 cut(s) 320
Hpy188I TCNGA 2 cut(s) 152, 196
Hpy188III TCNNGA 2 cut(s) 85, 223
HpyAV CCTTC 1 cut(s) 119
HpyCH4V TGCA 1 cut(s) 53
HpyF10VI GCNNNNNNNGC 3 cut(s) 135, 276, 285
Hsp92II CATG 2 cut(s) 107, 283
Ksp22I TGATCA 1 cut(s) 238
Kzo9I GATC 4 cut(s) 87, 147, 238, 316
LpnPI CCDG 4 cut(s) 291, 318, 321, 348
LweI GCATC 1 cut(s) 22
MabI ACCWGGT 1 cut(s) 304
MaeI CTAG 1 cut(s) 297
MalI GATC 4 cut(s) 89, 149, 240, 318
MboI GATC 4 cut(s) 87, 147, 238, 316
MboII GAAGA 2 cut(s) 51, 54
MlyI GAGTC 1 cut(s) 50
MnlI CCTC 4 cut(s) 107, 193, 255, 293
MseI TTAA 2 cut(s) 162, 168
MspR9I CCNGG 2 cut(s) 306, 336
Mva1269I GAATGC 1 cut(s) 347
MvaI CCWGG 2 cut(s) 306, 336
MwoI GCNNNNNNNGC 3 cut(s) 135, 276, 285
NdeII GATC 4 cut(s) 87, 147, 238, 316
NlaIII CATG 2 cut(s) 107, 283
NspI RCATGY 1 cut(s) 107
PciI ACATGT 1 cut(s) 103
PctI GAATGC 1 cut(s) 347
PfeI GAWTC 1 cut(s) 191
PflMI CCANNNNNTGG 1 cut(s) 335
PleI GAGTC 1 cut(s) 50
PpsI GAGTC 1 cut(s) 50
PscI ACATGT 1 cut(s) 103
Psp6I CCWGG 2 cut(s) 304, 334
PspGI CCWGG 2 cut(s) 304, 334
PspPI GGNCC 4 cut(s) 115, 152, 302, 347
SaqAI TTAA 2 cut(s) 162, 168
Sau3AI GATC 4 cut(s) 87, 147, 238, 316
Sau96I GGNCC 4 cut(s) 115, 152, 302, 347
SchI GAGTC 1 cut(s) 50
ScrFI CCNGG 2 cut(s) 306, 336
SetI ASST 7 cut(s) 81, 99, 146, 157, 168, 290, 310
SexAI ACCWGGT 1 cut(s) 304
SfaNI GCATC 1 cut(s) 22
SfcI CTRYAG 1 cut(s) 255
SinI GGWCC 3 cut(s) 115, 152, 302
SsiI CCGC 2 cut(s) 136, 345
SspMI CTAG 1 cut(s) 297
StyD4I CCNGG 2 cut(s) 304, 334
TaqI TCGA 1 cut(s) 42
TfiI GAWTC 1 cut(s) 191
Tru1I TTAA 2 cut(s) 162, 168
Tru9I TTAA 2 cut(s) 162, 168
TscAI CASTG 2 cut(s) 34, 136
TspDTI ATGAA 2 cut(s) 17, 192
TspGWI ACGGA 1 cut(s) 137
TspRI CASTG 2 cut(s) 34, 136
Van91I CCANNNNNTGG 1 cut(s) 335
VpaK11BI GGWCC 3 cut(s) 115, 152, 302
XceI RCATGY 1 cut(s) 107
XspI CTAG 1 cut(s) 297
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.