Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8003062.1

Orthogroup ID

OG0025547

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 528

Gene Structure 528 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8003062.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 278 bp

aattcaggagatattgatgaagcagtggcatcagctattacggaaaatgatattgtagcttcagccgtattatctggaaataggaattttgagggccgtgtacatcctttaacacgggctaattatcttgcttctcctccccttgtggttgcttatgcacttgctggcacggtggatattgattttgacactgaaaatataggggtgggaaaagatggaaagaagatatttttcagggatatatggccatctaatcaagaagtagcagaggtgagatt

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003676 GO:0003723 GO:0003729 GO:0003824 GO:0003994 GO:0005488 GO:0005507 GO:0005575 GO:0005576 GO:0005622 GO:0005623 GO:0005737 GO:0005739 GO:0005773 GO:0005829 GO:0005886 GO:0005911 GO:0006082 GO:0006101 GO:0006102 GO:0006950 GO:0006970 GO:0008150 GO:0008152 GO:0009506 GO:0009605 GO:0009628 GO:0009651 GO:0009987 GO:0009991 GO:0016020 GO:0016829 GO:0016835 GO:0016836 GO:0016999 GO:0017144 GO:0019752 GO:0030054 GO:0031667 GO:0042594 GO:0043167 GO:0043169 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043436 GO:0044237 GO:0044281 GO:0044424 GO:0044444 GO:0044464 GO:0046872 GO:0046914 GO:0048027 GO:0048046 GO:0050896 GO:0055044 GO:0071704 GO:0071944 GO:0072350 GO:0097159 GO:1901363 GO:1990641

KEGG Pathways

Metabolic & Signaling

ko00020 ko00630 ko00720 ko01100 ko01110 ko01120 ko01130 ko01200 ko01210 ko01230 map00020 map00630 map00720 map01100 map01110 map01120 map01130 map01200 map01210 map01230

Pfam Domains

Protein Families

Aconitase Aconitase_C

Protein Analysis

92

Amino Acids

9.89

Weight (kDa)

4.5

Isoelectric Point (pI)

21.85

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0025547)

Species	Orthologous Gene IDs
rosa_multiflora	Rmu_co8003062.1_g000001 Rmu_sc0002908.1_g000026 Rmu_sc0023758.1_g000002

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcoI	YGGCCR	1 cut(s)	245
AcsI	RAATTY	1 cut(s)	85
AcuI	CTGAAG	1 cut(s)	45
AfaI	GTAC	1 cut(s)	102
AluBI	AGCT	2 cut(s)	35, 59
AluI	AGCT	2 cut(s)	35, 59
AoxI	GGCC	2 cut(s)	94, 245
ApoI	RAATTY	1 cut(s)	85
AspS9I	GGNCC	1 cut(s)	94
BalI	TGGCCA	1 cut(s)	247
BccI	CCATC	2 cut(s)	209, 256
BceAI	ACGGC	2 cut(s)	50, 81
BmgT120I	GGNCC	1 cut(s)	94
BmsI	GCATC	1 cut(s)	38
BseGI	GGATG	1 cut(s)	103
BseRI	GAGGAG	1 cut(s)	126
BshFI	GGCC	2 cut(s)	96, 247
BsnI	GGCC	2 cut(s)	96, 247
Bsp1407I	TGTACA	1 cut(s)	100
BspANI	GGCC	2 cut(s)	96, 247
BsrGI	TGTACA	1 cut(s)	100
Bst4CI	ACNGT	1 cut(s)	172
BstAUI	TGTACA	1 cut(s)	100
BstC8I	GCNNGC	1 cut(s)	166
BstF5I	GGATG	1 cut(s)	103
BsuRI	GGCC	2 cut(s)	96, 247
BtsCI	GGATG	1 cut(s)	103
BtsI	GCAGTG	1 cut(s)	30
BtsIMutI	CAGTG	2 cut(s)	30, 189
Cac8I	GCNNGC	1 cut(s)	166
Cfr13I	GGNCC	1 cut(s)	94
Csp6I	GTAC	1 cut(s)	101
CviJI	RGCY	6 cut(s)	35, 59, 65, 96, 119, 247
CviKI_1	RGCY	6 cut(s)	35, 59, 65, 96, 119, 247
CviQI	GTAC	1 cut(s)	101
EaeI	YGGCCR	1 cut(s)	245
Eco57I	CTGAAG	1 cut(s)	45
FaiI	YATR	4 cut(s)	156, 200, 242, 244
FokI	GGATG	1 cut(s)	90
HaeIII	GGCC	2 cut(s)	96, 247
Hpy166II	GTNNAC	1 cut(s)	101
Hpy188III	TCNNGA	3 cut(s)	6, 75, 257
Hpy8I	GTNNAC	1 cut(s)	101
HpyCH4III	ACNGT	1 cut(s)	172
HpyCH4V	TGCA	1 cut(s)	158
LpnPI	CCDG	3 cut(s)	60, 150, 220
LweI	GCATC	1 cut(s)	38
MboII	GAAGA	1 cut(s)	235
MlsI	TGGCCA	1 cut(s)	247
MluCI	AATT	2 cut(s)	85, 121
MluNI	TGGCCA	1 cut(s)	247
MnlI	CCTC	3 cut(s)	85, 147, 262
Mox20I	TGGCCA	1 cut(s)	247
MscI	TGGCCA	1 cut(s)	247
MseI	TTAA	1 cut(s)	110
Msp20I	TGGCCA	1 cut(s)	247
PspPI	GGNCC	1 cut(s)	94
RsaI	GTAC	1 cut(s)	102
RsaNI	GTAC	1 cut(s)	101
SaqAI	TTAA	1 cut(s)	110
Sau96I	GGNCC	1 cut(s)	94
SetI	ASST	3 cut(s)	37, 61, 273
SfaNI	GCATC	1 cut(s)	38
Sse9I	AATT	2 cut(s)	85, 121
TaaI	ACNGT	1 cut(s)	172
TasI	AATT	2 cut(s)	85, 121
TatI	WGTACW	1 cut(s)	100
Tru1I	TTAA	1 cut(s)	110
Tru9I	TTAA	1 cut(s)	110
TscAI	CASTG	2 cut(s)	30, 196
TspDTI	ATGAA	1 cut(s)	33
TspGWI	ACGGA	1 cut(s)	56
TspRI	CASTG	2 cut(s)	30, 196
XapI	RAATTY	1 cut(s)	85

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.