Rmu_co8016466.1_g000001
ERF Family

Belongs to the protein kinase superfamily

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8016466.1
Physical Location & Seq
Reverse (-)
1 .. 446
446 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8016466.1_g000001.1.cds

Sequence Viewer

Length: 165 bp
atgatcttcggggcatatccctttgaagatcctcaggaccctttaaactttacaaaaacaattcggcgaattcttagtgtacactactcaatcccacaaaatatcggagtttccggggaatgtagacatctgttttctaaaatatttgtggcaaacccagaacag

Protein Analysis

55

Amino Acids

6.32

Weight (kDa)

6.7

Isoelectric Point (pI)

69.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0031624)

Species Orthologous Gene IDs
rosa_multiflora Rmu_co8016466.1_g000001
rosa_samantha Rh7CG489200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 124
AclWI GGATC 1 cut(s) 23
AcsI RAATTY 1 cut(s) 69
AfaI GTAC 1 cut(s) 81
AgsI TTSAA 1 cut(s) 26
AlwI GGATC 1 cut(s) 23
ApoI RAATTY 1 cut(s) 69
AspS9I GGNCC 1 cut(s) 37
AsuC2I CCSGG 1 cut(s) 115
AvaII GGWCC 1 cut(s) 37
AxyI CCTNAGG 1 cut(s) 33
BcnI CCSGG 1 cut(s) 115
Bme1390I CCNGG 1 cut(s) 115
Bme18I GGWCC 1 cut(s) 37
BmgT120I GGNCC 1 cut(s) 37
BmiI GGNNCC 1 cut(s) 39
BmrFI CCNGG 1 cut(s) 115
BpuMI CCSGG 1 cut(s) 115
BsaJI CCNNGG 1 cut(s) 114
Bse21I CCTNAGG 1 cut(s) 33
BseDI CCNNGG 1 cut(s) 114
BseMII CTCAG 1 cut(s) 47
BsiSI CCGG 1 cut(s) 114
Bsp1407I TGTACA 1 cut(s) 79
Bsp143I GATC 2 cut(s) 3, 28
BspCNI CTCAG 1 cut(s) 46
BspLI GGNNCC 1 cut(s) 39
BspPI GGATC 1 cut(s) 23
BsrGI TGTACA 1 cut(s) 79
BssECI CCNNGG 1 cut(s) 114
BssMI GATC 2 cut(s) 3, 28
BstAUI TGTACA 1 cut(s) 79
BstDEI CTNAG 2 cut(s) 33, 74
BstKTI GATC 2 cut(s) 6, 31
BstMBI GATC 2 cut(s) 3, 28
BstSCI CCNGG 1 cut(s) 113
BstX2I RGATCY 1 cut(s) 28
BstYI RGATCY 1 cut(s) 28
Bsu36I CCTNAGG 1 cut(s) 33
Cfr13I GGNCC 1 cut(s) 37
Csp6I GTAC 1 cut(s) 80
CviQI GTAC 1 cut(s) 80
DdeI CTNAG 2 cut(s) 33, 74
DpnI GATC 2 cut(s) 5, 30
DpnII GATC 2 cut(s) 3, 28
DraI TTTAAA 1 cut(s) 45
Eco47I GGWCC 1 cut(s) 37
Eco81I CCTNAGG 1 cut(s) 33
EcoO109I RGGNCCY 1 cut(s) 37
EcoRI GAATTC 1 cut(s) 69
FaiI YATR 1 cut(s) 16
FblI GTMKAC 1 cut(s) 124
HapII CCGG 1 cut(s) 114
HpaII CCGG 1 cut(s) 114
Hpy166II GTNNAC 3 cut(s) 80, 82, 125
Hpy188I TCNGA 1 cut(s) 107
Hpy188III TCNNGA 1 cut(s) 35
Hpy8I GTNNAC 3 cut(s) 80, 82, 125
HpyF3I CTNAG 2 cut(s) 33, 74
Kzo9I GATC 2 cut(s) 3, 28
LpnPI CCDG 2 cut(s) 20, 127
MalI GATC 2 cut(s) 5, 30
MboI GATC 2 cut(s) 3, 28
MboII GAAGA 1 cut(s) 38
MflI RGATCY 1 cut(s) 28
MluCI AATT 2 cut(s) 60, 69
MnlI CCTC 1 cut(s) 42
MseI TTAA 1 cut(s) 44
MspI CCGG 1 cut(s) 114
MspR9I CCNGG 1 cut(s) 115
NciI CCSGG 1 cut(s) 115
NdeII GATC 2 cut(s) 3, 28
NlaIV GGNNCC 1 cut(s) 39
PpuMI RGGWCCY 1 cut(s) 37
Psp5II RGGWCCY 1 cut(s) 37
PspN4I GGNNCC 1 cut(s) 39
PspPI GGNCC 1 cut(s) 37
PspPPI RGGWCCY 1 cut(s) 37
PsuI RGATCY 1 cut(s) 28
RsaI GTAC 1 cut(s) 81
RsaNI GTAC 1 cut(s) 80
SaqAI TTAA 1 cut(s) 44
Sau3AI GATC 2 cut(s) 3, 28
Sau96I GGNCC 1 cut(s) 37
ScrFI CCNGG 1 cut(s) 115
SgeI CNNG 4 cut(s) 22, 47, 126, 127
SinI GGWCC 1 cut(s) 37
Sse9I AATT 2 cut(s) 60, 69
SspI AATATT 1 cut(s) 144
StyD4I CCNGG 1 cut(s) 113
TasI AATT 2 cut(s) 60, 69
TatI WGTACW 1 cut(s) 79
Tru1I TTAA 1 cut(s) 44
Tru9I TTAA 1 cut(s) 44
VpaK11BI GGWCC 1 cut(s) 37
XapI RAATTY 1 cut(s) 69
XmiI GTMKAC 1 cut(s) 124
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.