Rmu_co8063360.1_g000001

ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8063360.1
OG0025593
Physical Location & Seq
Forward (+)
1 .. 570
570 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8063360.1_g000001.1.cds

Sequence Viewer

Length: 570 bp
ctgagaaacttgatggtagaattcgaccagagcgccaaatgcgagggtttcgtgaagttttgggttatgctgatttaattgacctgggttactttggagttccatatacttggagtgattctgagacaaaactgcgtttggatagagtagtggctactccaacatggctagatctgttcatgcattctagggttattcatcttccaccaagtaagtcagatcatattccgattctcttacaagtaagttcgaagcctatcgcaaagcaacagcgattccatcgtttcaagtttgagactttctggcttcaaaatgctgagtgtgatccgctagttcagaatcattggggttcggtaattactggacaacctttgttctgtgtgtctaagaaaattgagagaactggtattgctttggatcgatggcagagagctacttttggggatcgacaaaaagcaatgttcgcagttagacaaagattggaggtgattatggggctccctcactctactgaacttcaggaagaaaaggttgaccttatggctcagttagaactgttgctatctcaag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_1 RVT_3 zf-RVT

Protein Analysis

189

Amino Acids

22.06

Weight (kDa)

8.96

Isoelectric Point (pI)

46.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0025593)

Species Orthologous Gene IDs
rosa_multiflora Rmu_co8063360.1_g000001 Rmu_sc0005212.1_g000003 Rmu_sc0011745.1_g000001

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 328
AclWI GGATC 3 cut(s) 319, 425, 452
AcsI RAATTY 1 cut(s) 20
AcuI CTGAAG 1 cut(s) 502
AgsI TTSAA 2 cut(s) 288, 310
AjnI CCWGG 1 cut(s) 83
AluBI AGCT 1 cut(s) 433
AluI AGCT 1 cut(s) 433
Alw26I GTCTC 2 cut(s) 118, 289
AlwI GGATC 3 cut(s) 319, 425, 452
ApoI RAATTY 1 cut(s) 20
AspLEI GCGC 1 cut(s) 35
AsuHPI GGTGA 1 cut(s) 498
AsuII TTCGAA 1 cut(s) 250
BanII GRGCYC 1 cut(s) 500
BccI CCATC 3 cut(s) 7, 287, 416
BciT130I CCWGG 1 cut(s) 85
BcoDI GTCTC 2 cut(s) 118, 289
BfaI CTAG 3 cut(s) 169, 188, 331
BfoI RGCGCY 1 cut(s) 36
BglII AGATCT 1 cut(s) 171
Bme1390I CCNGG 1 cut(s) 85
BmiI GGNNCC 1 cut(s) 499
BmrFI CCNGG 1 cut(s) 85
Bpu14I TTCGAA 1 cut(s) 250
BpuEI CTTGAG 1 cut(s) 551
Bsa29I ATCGAT 1 cut(s) 420
BsaJI CCNNGG 1 cut(s) 84
Bse1I ACTGG 2 cut(s) 366, 408
Bse3DI GCAATG 1 cut(s) 464
BseBI CCWGG 1 cut(s) 85
BseCI ATCGAT 1 cut(s) 420
BseDI CCNNGG 1 cut(s) 84
BseMI GCAATG 1 cut(s) 464
BseMII CTCAG 3 cut(s) 113, 308, 559
BseNI ACTGG 2 cut(s) 366, 408
BshVI ATCGAT 1 cut(s) 420
BsmAI GTCTC 2 cut(s) 118, 289
BsmI GAATGC 1 cut(s) 183
Bsp119I TTCGAA 1 cut(s) 250
Bsp1286I GDGCHC 1 cut(s) 500
Bsp143I GATC 5 cut(s) 171, 219, 324, 417, 444
BspACI CCGC 1 cut(s) 328
BspCNI CTCAG 3 cut(s) 114, 309, 558
BspDI ATCGAT 1 cut(s) 420
BspLI GGNNCC 1 cut(s) 499
BspPI GGATC 3 cut(s) 319, 425, 452
BspT104I TTCGAA 1 cut(s) 250
BsrDI GCAATG 1 cut(s) 464
BsrI ACTGG 2 cut(s) 366, 408
BssECI CCNNGG 1 cut(s) 84
BssMI GATC 5 cut(s) 171, 219, 324, 417, 444
Bst2UI CCWGG 1 cut(s) 85
Bst4CI ACNGT 1 cut(s) 557
BstBI TTCGAA 1 cut(s) 250
BstDEI CTNAG 5 cut(s) 2, 122, 317, 386, 545
BstH2I RGCGCY 1 cut(s) 36
BstHHI GCGC 1 cut(s) 35
BstKTI GATC 5 cut(s) 174, 222, 327, 420, 447
BstMAI GTCTC 2 cut(s) 118, 289
BstMBI GATC 5 cut(s) 171, 219, 324, 417, 444
BstMWI GCNNNNNNNGC 2 cut(s) 39, 463
BstNI CCWGG 1 cut(s) 85
BstSCI CCNGG 1 cut(s) 83
BstX2I RGATCY 1 cut(s) 171
BstXI CCANNNNNNTGG 1 cut(s) 110
BstYI RGATCY 1 cut(s) 171
Bsu15I ATCGAT 1 cut(s) 420
BsuTUI ATCGAT 1 cut(s) 420
CfoI GCGC 1 cut(s) 35
ClaI ATCGAT 1 cut(s) 420
CviAII CATG 2 cut(s) 164, 180
CviJI RGCY 7 cut(s) 154, 168, 255, 306, 433, 498, 544
CviKI_1 RGCY 7 cut(s) 154, 168, 255, 306, 433, 498, 544
DdeI CTNAG 5 cut(s) 2, 122, 317, 386, 545
DpnI GATC 5 cut(s) 173, 221, 326, 419, 446
DpnII GATC 5 cut(s) 171, 219, 324, 417, 444
Eco24I GRGCYC 1 cut(s) 500
Eco57I CTGAAG 1 cut(s) 502
EcoRI GAATTC 1 cut(s) 20
EcoRII CCWGG 1 cut(s) 83
EcoT22I ATGCAT 1 cut(s) 185
EcoT38I GRGCYC 1 cut(s) 500
FaeI CATG 2 cut(s) 167, 183
FaiI YATR 8 cut(s) 68, 105, 107, 165, 181, 224, 493, 541
FatI CATG 2 cut(s) 163, 179
FriOI GRGCYC 1 cut(s) 500
FspBI CTAG 3 cut(s) 169, 188, 331
GlaI GCGC 1 cut(s) 34
HaeII RGCGCY 1 cut(s) 36
HhaI GCGC 1 cut(s) 35
Hin1II CATG 2 cut(s) 167, 183
Hin6I GCGC 1 cut(s) 33
HinP1I GCGC 1 cut(s) 33
HincII GTYRAC 1 cut(s) 534
HindII GTYRAC 1 cut(s) 534
HinfI GANTC 4 cut(s) 118, 231, 275, 339
HphI GGTGA 1 cut(s) 498
Hpy166II GTNNAC 1 cut(s) 534
Hpy188I TCNGA 4 cut(s) 123, 219, 230, 338
Hpy188III TCNNGA 2 cut(s) 52, 520
Hpy8I GTNNAC 1 cut(s) 534
HpyCH4III ACNGT 1 cut(s) 557
HpyCH4V TGCA 1 cut(s) 183
HpyF10VI GCNNNNNNNGC 2 cut(s) 39, 463
HpyF3I CTNAG 5 cut(s) 2, 122, 317, 386, 545
Hsp92II CATG 2 cut(s) 167, 183
HspAI GCGC 1 cut(s) 33
Kzo9I GATC 5 cut(s) 171, 219, 324, 417, 444
LmnI GCTCC 1 cut(s) 503
LpnPI CCDG 7 cut(s) 41, 70, 97, 288, 347, 389, 505
MaeI CTAG 3 cut(s) 169, 188, 331
MaeIII GTNAC 1 cut(s) 88
MalI GATC 5 cut(s) 173, 221, 326, 419, 446
MboI GATC 5 cut(s) 171, 219, 324, 417, 444
MboII GAAGA 2 cut(s) 193, 535
MflI RGATCY 1 cut(s) 171
MhlI GDGCHC 1 cut(s) 500
MluCI AATT 4 cut(s) 20, 77, 356, 392
MmeI TCCRAC 1 cut(s) 184
MnlI CCTC 3 cut(s) 37, 477, 512
Mph1103I ATGCAT 1 cut(s) 185
MseI TTAA 1 cut(s) 76
MspR9I CCNGG 1 cut(s) 85
Mva1269I GAATGC 1 cut(s) 183
MvaI CCWGG 1 cut(s) 85
MwoI GCNNNNNNNGC 2 cut(s) 39, 463
NdeII GATC 5 cut(s) 171, 219, 324, 417, 444
NlaIII CATG 2 cut(s) 167, 183
NlaIV GGNNCC 1 cut(s) 499
NsiI ATGCAT 1 cut(s) 185
NspV TTCGAA 1 cut(s) 250
PctI GAATGC 1 cut(s) 183
PfeI GAWTC 4 cut(s) 118, 231, 275, 339
Psp6I CCWGG 1 cut(s) 83
PspGI CCWGG 1 cut(s) 83
PspN4I GGNNCC 1 cut(s) 499
PsuI RGATCY 1 cut(s) 171
SaqAI TTAA 1 cut(s) 76
Sau3AI GATC 5 cut(s) 171, 219, 324, 417, 444
ScrFI CCNGG 1 cut(s) 85
SduI GDGCHC 1 cut(s) 500
SetI ASST 6 cut(s) 86, 372, 435, 488, 533, 539
SfuI TTCGAA 1 cut(s) 250
SmlI CTYRAG 1 cut(s) 566
SmoI CTYRAG 1 cut(s) 566
Sse9I AATT 4 cut(s) 20, 77, 356, 392
SsiI CCGC 1 cut(s) 328
SspMI CTAG 3 cut(s) 169, 188, 331
StyD4I CCNGG 1 cut(s) 83
TaaI ACNGT 1 cut(s) 557
TaqI TCGA 4 cut(s) 24, 250, 420, 447
TasI AATT 4 cut(s) 20, 77, 356, 392
TfiI GAWTC 4 cut(s) 118, 231, 275, 339
Tru1I TTAA 1 cut(s) 76
Tru9I TTAA 1 cut(s) 76
TspDTI ATGAA 2 cut(s) 168, 187
XapI RAATTY 1 cut(s) 20
XspI CTAG 3 cut(s) 169, 188, 331
Zsp2I ATGCAT 1 cut(s) 185
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.