Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8103366.1

Orthogroup ID

OG0031123

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 604

Gene Structure 604 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8103366.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 518 bp

aaacaaattttcaactcattgcaggttgaagacagcgaactagcagatgtggctgctgtcagtgcaggaaacaactatgaagtaggacaaatgattgctgaagccttgagtaaggtgggtcgaaagggtgtcgtgacacttgaagaggggaaaagtgctgagaacagtctttatgttgttgaaggaatgcaatttgatcgtggttatatctcaccttacttcgtcactgatagtgagaaaatggctgttgaatatgagaactgcaagttgcttcttgttgataaaaagataacaaatgcaagagaccttgttaacattttggaggatgctataagaggaggatacccagttgtgataattgccgaagacattgaacaagaagctctggcaactcttgttgtgaacaagctcagaggatctctaaagattgctgccctaaaagctcctggatttggagatcgcaagagccagtatctcgatgatattgctatattgaccggaggtatttgcacttccat

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0005488 GO:0005515 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005730 GO:0005737 GO:0005739 GO:0005829 GO:0005840 GO:0006457 GO:0006458 GO:0006996 GO:0007005 GO:0008150 GO:0009507 GO:0009526 GO:0009532 GO:0009536 GO:0009570 GO:0009941 GO:0009987 GO:0016020 GO:0016043 GO:0022626 GO:0031967 GO:0031974 GO:0031975 GO:0031981 GO:0032991 GO:0043226 GO:0043227 GO:0043228 GO:0043229 GO:0043231 GO:0043232 GO:0043233 GO:0044183 GO:0044422 GO:0044424 GO:0044428 GO:0044434 GO:0044435 GO:0044444 GO:0044445 GO:0044446 GO:0044464 GO:0051082 GO:0061077 GO:0070013 GO:0071840 GO:1990904

KEGG Pathways

Metabolic & Signaling

ko03018 ko04212 ko04940 ko05134 ko05152 map03018 map04212 map04940 map05134 map05152

Pfam Domains

Protein Families

Cpn60_TCP1

Protein Analysis

172

Amino Acids

18.65

Weight (kDa)

4.66

Isoelectric Point (pI)

31.55

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0031123)

Species	Orthologous Gene IDs
rosa_multiflora	Rmu_co8103366.1_g000001 Rmu_sc0001287.1_g000044

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	13
AclWI	GGATC	1 cut(s)	424
AcsI	RAATTY	1 cut(s)	6
AcuI	CTGAAG	1 cut(s)	120
AfiI	CCNNNNNNNGG	1 cut(s)	452
AgsI	TTSAA	6 cut(s)	13, 29, 143, 182, 251, 374
AjnI	CCWGG	1 cut(s)	445
AluBI	AGCT	3 cut(s)	383, 409, 443
AluI	AGCT	3 cut(s)	383, 409, 443
Alw26I	GTCTC	1 cut(s)	297
AlwI	GGATC	1 cut(s)	424
ApeKI	GCWGC	2 cut(s)	53, 431
ApoI	RAATTY	1 cut(s)	6
AsuHPI	GGTGA	1 cut(s)	204
BarI	GAAGNNNNNNTAC	1 cut(s)	496
BbsI	GAAGAC	2 cut(s)	36, 372
BbvI	GCAGC	2 cut(s)	40, 418
BcgI	CGANNNNNNTGC	4 cut(s)	179, 213, 467, 501
BciT130I	CCWGG	1 cut(s)	447
BciVI	GTATCC	1 cut(s)	335
BcoDI	GTCTC	1 cut(s)	297
BfaI	CTAG	1 cut(s)	41
BfuAI	ACCTGC	1 cut(s)	13
BfuI	GTATCC	1 cut(s)	335
BisI	GCNGC	2 cut(s)	54, 432
BlsI	GCNGC	2 cut(s)	55, 433
Bme1390I	CCNGG	1 cut(s)	447
BmrFI	CCNGG	1 cut(s)	447
BmrI	ACTGGG	1 cut(s)	341
BmsI	GCATC	1 cut(s)	316
BmuI	ACTGGG	1 cut(s)	341
BpiI	GAAGAC	2 cut(s)	36, 372
BpuEI	CTTGAG	1 cut(s)	127
BsaI	GGTCTC	1 cut(s)	297
BsaWI	WCCGGW	1 cut(s)	497
Bsc4I	CCNNNNNNNGG	1 cut(s)	452
Bse1I	ACTGG	2 cut(s)	347, 469
Bse3DI	GCAATG	1 cut(s)	17
BseBI	CCWGG	1 cut(s)	447
BseGI	GGATG	1 cut(s)	331
BseLI	CCNNNNNNNGG	1 cut(s)	452
BseMI	GCAATG	1 cut(s)	17
BseMII	CTCAG	2 cut(s)	150, 424
BseNI	ACTGG	2 cut(s)	347, 469
BseRI	GAGGAG	1 cut(s)	351
BseXI	GCAGC	2 cut(s)	40, 418
BsgI	GTGCAG	1 cut(s)	84
BsiSI	CCGG	1 cut(s)	498
BslI	CCNNNNNNNGG	1 cut(s)	452
BsmAI	GTCTC	1 cut(s)	297
BsmI	GAATGC	1 cut(s)	192
Bso31I	GGTCTC	1 cut(s)	297
Bsp143I	GATC	3 cut(s)	196, 416, 457
BspCNI	CTCAG	2 cut(s)	151, 423
BspMI	ACCTGC	1 cut(s)	13
BspPI	GGATC	1 cut(s)	424
BspTNI	GGTCTC	1 cut(s)	297
BsrDI	GCAATG	1 cut(s)	17
BsrI	ACTGG	2 cut(s)	347, 469
BssMI	GATC	3 cut(s)	196, 416, 457
Bst2UI	CCWGG	1 cut(s)	447
Bst4CI	ACNGT	1 cut(s)	167
Bst6I	CTCTTC	1 cut(s)	138
BstDEI	CTNAG	2 cut(s)	159, 410
BstF5I	GGATG	1 cut(s)	331
BstKTI	GATC	3 cut(s)	199, 419, 460
BstMAI	GTCTC	1 cut(s)	297
BstMBI	GATC	3 cut(s)	196, 416, 457
BstMWI	GCNNNNNNNGC	3 cut(s)	50, 62, 440
BstNI	CCWGG	1 cut(s)	447
BstSCI	CCNGG	1 cut(s)	445
BstV1I	GCAGC	2 cut(s)	40, 418
BstV2I	GAAGAC	2 cut(s)	36, 372
BstX2I	RGATCY	1 cut(s)	416
BstYI	RGATCY	1 cut(s)	416
BsuI	GTATCC	1 cut(s)	335
BtsCI	GGATG	1 cut(s)	331
BtsIMutI	CAGTG	2 cut(s)	67, 225
BveI	ACCTGC	1 cut(s)	13
CviJI	RGCY	7 cut(s)	53, 104, 245, 383, 409, 443, 468
CviKI_1	RGCY	7 cut(s)	53, 104, 245, 383, 409, 443, 468
DdeI	CTNAG	2 cut(s)	159, 410
DpnI	GATC	3 cut(s)	198, 418, 459
DpnII	GATC	3 cut(s)	196, 416, 457
Eam1104I	CTCTTC	1 cut(s)	138
EarI	CTCTTC	1 cut(s)	138
Eco31I	GGTCTC	1 cut(s)	297
Eco57I	CTGAAG	1 cut(s)	120
EcoRII	CCWGG	1 cut(s)	445
FaiI	YATR	6 cut(s)	78, 174, 207, 255, 332, 491
Fnu4HI	GCNGC	2 cut(s)	54, 432
FokI	GGATG	1 cut(s)	338
Fsp4HI	GCNGC	2 cut(s)	54, 432
FspBI	CTAG	1 cut(s)	41
GluI	GCNGC	2 cut(s)	54, 432
HapII	CCGG	1 cut(s)	498
HincII	GTYRAC	1 cut(s)	313
HindII	GTYRAC	1 cut(s)	313
HpaI	GTTAAC	1 cut(s)	313
HpaII	CCGG	1 cut(s)	498
HphI	GGTGA	1 cut(s)	204
Hpy166II	GTNNAC	2 cut(s)	313, 403
Hpy188I	TCNGA	1 cut(s)	413
Hpy188III	TCNNGA	2 cut(s)	133, 476
Hpy8I	GTNNAC	2 cut(s)	313, 403
HpyAV	CCTTC	1 cut(s)	176
HpyCH4III	ACNGT	1 cut(s)	167
HpyCH4V	TGCA	6 cut(s)	22, 65, 190, 264, 299, 510
HpyF10VI	GCNNNNNNNGC	3 cut(s)	50, 62, 440
HpyF3I	CTNAG	2 cut(s)	159, 410
KspAI	GTTAAC	1 cut(s)	313
Kzo9I	GATC	3 cut(s)	196, 416, 457
LmnI	GCTCC	1 cut(s)	448
LpnPI	CCDG	8 cut(s)	8, 51, 360, 371, 432, 459, 482, 511
Lsp1109I	GCAGC	2 cut(s)	40, 418
LweI	GCATC	1 cut(s)	316
MaeI	CTAG	1 cut(s)	41
MaeIII	GTNAC	2 cut(s)	133, 223
MalI	GATC	3 cut(s)	198, 418, 459
MboI	GATC	3 cut(s)	196, 416, 457
MboII	GAAGA	3 cut(s)	41, 155, 377
MflI	RGATCY	1 cut(s)	416
MluCI	AATT	3 cut(s)	6, 191, 357
MnlI	CCTC	6 cut(s)	139, 316, 329, 332, 407, 494
MseI	TTAA	1 cut(s)	312
MspI	CCGG	1 cut(s)	498
MspR9I	CCNGG	1 cut(s)	447
Mva1269I	GAATGC	1 cut(s)	192
MvaI	CCWGG	1 cut(s)	447
MwoI	GCNNNNNNNGC	3 cut(s)	50, 62, 440
NdeII	GATC	3 cut(s)	196, 416, 457
NmuCI	GTSAC	2 cut(s)	133, 223
PctI	GAATGC	1 cut(s)	192
PfoI	TCCNGGA	1 cut(s)	445
PkrI	GCNGC	2 cut(s)	55, 433
Psp6I	CCWGG	1 cut(s)	445
PspGI	CCWGG	1 cut(s)	445
PsuI	RGATCY	1 cut(s)	416
SaqAI	TTAA	1 cut(s)	312
SatI	GCNGC	2 cut(s)	54, 432
Sau3AI	GATC	3 cut(s)	196, 416, 457
ScrFI	CCNGG	1 cut(s)	447
SetI	ASST	8 cut(s)	27, 117, 217, 309, 385, 411, 445, 505
SfaNI	GCATC	1 cut(s)	316
SmlI	CTYRAG	1 cut(s)	106
SmoI	CTYRAG	1 cut(s)	106
Sse9I	AATT	3 cut(s)	6, 191, 357
SspMI	CTAG	1 cut(s)	41
StyD4I	CCNGG	1 cut(s)	445
TaaI	ACNGT	1 cut(s)	167
TaqI	TCGA	2 cut(s)	121, 477
TasI	AATT	3 cut(s)	6, 191, 357
Tru1I	TTAA	1 cut(s)	312
Tru9I	TTAA	1 cut(s)	312
TscAI	CASTG	2 cut(s)	67, 232
TseFI	GTSAC	2 cut(s)	133, 223
TseI	GCWGC	2 cut(s)	53, 431
Tsp45I	GTSAC	2 cut(s)	133, 223
TspDTI	ATGAA	1 cut(s)	93
TspRI	CASTG	2 cut(s)	67, 232
XapI	RAATTY	1 cut(s)	6
XspI	CTAG	1 cut(s)	41

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.