Rmu_co8163004.1_g000001

f-box protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8163004.1
OG0022712
Physical Location & Seq
Reverse (-)
1 .. 624
624 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8163004.1_g000001.1.cds

Sequence Viewer

Length: 356 bp
atggagcggcagaaggagcaaaaacaaggaccgcaaatggggattggtttggagaccttacccagctgcgtattgatcagcgctatcttccccaagctggaactggaaaccctgtgctctctcgcttgcgtcagcagagcaatgaactcctcagtctctcaagccctttcttcactctcctccctcaatctctccgtagaaggtcttaatagcctcaccctcaattgcctgcgcctagacgactcgtcgttggcggtttttctgggtgcacatctccaagaactgaacttgctgtgctgctccttgatgtcgtatcaagtccttgcttccattggagagggttgccccaatctcag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
F-box LRR_6

Protein Analysis

118

Amino Acids

12.59

Weight (kDa)

4.75

Isoelectric Point (pI)

46.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0022712)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr3g0493531
rosa_multiflora Rmu_co8163004.1_g000001
rosa_samantha Rh4DG094700 Rh5DG521400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 7
AciI CCGC 3 cut(s) 7, 32, 254
AfeI AGCGCT 1 cut(s) 82
AfiI CCNNNNNNNGG 2 cut(s) 38, 97
AhdI GACNNNNNGTC 1 cut(s) 244
AluBI AGCT 2 cut(s) 66, 97
AluI AGCT 2 cut(s) 66, 97
Alw21I GWGCWC 2 cut(s) 119, 271
Alw26I GTCTC 2 cut(s) 47, 160
Alw44I GTGCAC 1 cut(s) 267
Aor51HI AGCGCT 1 cut(s) 82
ApaLI GTGCAC 1 cut(s) 267
ApeKI GCWGC 2 cut(s) 66, 297
AspLEI GCGC 2 cut(s) 83, 234
AspS9I GGNCC 1 cut(s) 29
AsuHPI GGTGA 1 cut(s) 208
AvaII GGWCC 1 cut(s) 29
BaeGI GKGCMC 1 cut(s) 271
Bbv12I GWGCWC 2 cut(s) 119, 271
BbvI GCAGC 2 cut(s) 53, 284
BclI TGATCA 1 cut(s) 75
BcoDI GTCTC 2 cut(s) 47, 160
BfaI CTAG 1 cut(s) 236
BfoI RGCGCY 1 cut(s) 84
BisI GCNGC 3 cut(s) 8, 67, 298
BlsI GCNGC 3 cut(s) 9, 68, 299
Bme18I GGWCC 1 cut(s) 29
BmeRI GACNNNNNGTC 1 cut(s) 244
BmgT120I GGNCC 1 cut(s) 29
BpuEI CTTGAG 1 cut(s) 144
BsaI GGTCTC 1 cut(s) 47
Bsc4I CCNNNNNNNGG 2 cut(s) 38, 97
Bse1I ACTGG 1 cut(s) 108
Bse3DI GCAATG 1 cut(s) 147
BseLI CCNNNNNNNGG 2 cut(s) 38, 97
BseMI GCAATG 1 cut(s) 147
BseMII CTCAG 1 cut(s) 165
BseNI ACTGG 1 cut(s) 108
BseRI GAGGAG 2 cut(s) 139, 169
BseSI GKGCMC 1 cut(s) 271
BseXI GCAGC 2 cut(s) 53, 284
BseYI CCCAGC 1 cut(s) 62
BsiHKAI GWGCWC 2 cut(s) 119, 271
BslI CCNNNNNNNGG 2 cut(s) 38, 97
BsmAI GTCTC 2 cut(s) 47, 160
Bso31I GGTCTC 1 cut(s) 47
Bsp1286I GDGCHC 2 cut(s) 119, 271
Bsp143I GATC 1 cut(s) 75
BspACI CCGC 3 cut(s) 7, 32, 254
BspCNI CTCAG 1 cut(s) 164
BspTNI GGTCTC 1 cut(s) 47
BsrBI CCGCTC 1 cut(s) 7
BsrDI GCAATG 1 cut(s) 147
BsrI ACTGG 1 cut(s) 108
BssMI GATC 1 cut(s) 75
BstC8I GCNNGC 2 cut(s) 127, 230
BstDEI CTNAG 2 cut(s) 151, 353
BstH2I RGCGCY 1 cut(s) 84
BstHHI GCGC 2 cut(s) 83, 234
BstKTI GATC 1 cut(s) 78
BstMAI GTCTC 2 cut(s) 47, 160
BstMBI GATC 1 cut(s) 75
BstMWI GCNNNNNNNGC 1 cut(s) 16
BstSLI GKGCMC 1 cut(s) 271
BstV1I GCAGC 2 cut(s) 53, 284
Cac8I GCNNGC 2 cut(s) 127, 230
CfoI GCGC 2 cut(s) 83, 234
Cfr13I GGNCC 1 cut(s) 29
CseI GACGC 1 cut(s) 118
CviJI RGCY 4 cut(s) 66, 97, 164, 213
CviKI_1 RGCY 4 cut(s) 66, 97, 164, 213
DdeI CTNAG 2 cut(s) 151, 353
DpnI GATC 1 cut(s) 77
DpnII GATC 1 cut(s) 75
DriI GACNNNNNGTC 1 cut(s) 244
Eam1105I GACNNNNNGTC 1 cut(s) 244
Eco31I GGTCTC 1 cut(s) 47
Eco47I GGWCC 1 cut(s) 29
Eco47III AGCGCT 1 cut(s) 82
FbaI TGATCA 1 cut(s) 75
Fnu4HI GCNGC 3 cut(s) 8, 67, 298
Fsp4HI GCNGC 3 cut(s) 8, 67, 298
FspBI CTAG 1 cut(s) 236
GlaI GCGC 2 cut(s) 82, 233
GluI GCNGC 3 cut(s) 8, 67, 298
GsaI CCCAGC 1 cut(s) 66
HaeII RGCGCY 1 cut(s) 84
HgaI GACGC 1 cut(s) 118
HhaI GCGC 2 cut(s) 83, 234
Hin6I GCGC 2 cut(s) 81, 232
HinP1I GCGC 2 cut(s) 81, 232
HinfI GANTC 1 cut(s) 242
HphI GGTGA 1 cut(s) 208
Hpy166II GTNNAC 1 cut(s) 269
Hpy8I GTNNAC 1 cut(s) 269
Hpy99I CGWCG 1 cut(s) 250
HpyAV CCTTC 2 cut(s) 7, 194
HpyCH4V TGCA 1 cut(s) 269
HpyF10VI GCNNNNNNNGC 1 cut(s) 16
HpyF3I CTNAG 2 cut(s) 151, 353
HspAI GCGC 2 cut(s) 81, 232
Ksp22I TGATCA 1 cut(s) 75
Kzo9I GATC 1 cut(s) 75
LmnI GCTCC 3 cut(s) 4, 16, 305
LpnPI CCDG 6 cut(s) 76, 83, 89, 125, 242, 248
Lsp1109I GCAGC 2 cut(s) 53, 284
MaeI CTAG 1 cut(s) 236
MalI GATC 1 cut(s) 77
MbiI CCGCTC 1 cut(s) 7
MboI GATC 1 cut(s) 75
MboII GAAGA 2 cut(s) 79, 162
MfeI CAATTG 1 cut(s) 223
MhlI GDGCHC 2 cut(s) 119, 271
MluCI AATT 1 cut(s) 223
MlyI GAGTC 1 cut(s) 236
MnlI CCTC 6 cut(s) 160, 190, 194, 224, 230, 331
MseI TTAA 1 cut(s) 207
MspA1I CMGCKG 1 cut(s) 66
MunI CAATTG 1 cut(s) 223
MwoI GCNNNNNNNGC 1 cut(s) 16
NdeII GATC 1 cut(s) 75
PkrI GCNGC 3 cut(s) 9, 68, 299
PleI GAGTC 1 cut(s) 236
PpsI GAGTC 1 cut(s) 236
PspFI CCCAGC 1 cut(s) 62
PspPI GGNCC 1 cut(s) 29
PvuII CAGCTG 1 cut(s) 66
SaqAI TTAA 1 cut(s) 207
SatI GCNGC 3 cut(s) 8, 67, 298
Sau3AI GATC 1 cut(s) 75
Sau96I GGNCC 1 cut(s) 29
SchI GAGTC 1 cut(s) 236
SduI GDGCHC 2 cut(s) 119, 271
SetI ASST 4 cut(s) 59, 68, 99, 205
SinI GGWCC 1 cut(s) 29
SmlI CTYRAG 1 cut(s) 159
SmoI CTYRAG 1 cut(s) 159
Sse9I AATT 1 cut(s) 223
SsiI CCGC 3 cut(s) 7, 32, 254
SspMI CTAG 1 cut(s) 236
TasI AATT 1 cut(s) 223
TauI GCSGC 1 cut(s) 10
Tru1I TTAA 1 cut(s) 207
Tru9I TTAA 1 cut(s) 207
TseI GCWGC 2 cut(s) 66, 297
TspDTI ATGAA 1 cut(s) 158
TspGWI ACGGA 1 cut(s) 184
VneI GTGCAC 1 cut(s) 267
VpaK11BI GGWCC 1 cut(s) 29
XcmI CCANNNNNNNNNTGG 1 cut(s) 100
XspI CTAG 1 cut(s) 236
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.