Rmu_co8174024.1_g000001

Transcription initiation factor IIF subunit

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8174024.1
OG0023043
Physical Location & Seq
Reverse (-)
60 .. 677
618 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8174024.1_g000001.1.cds

Sequence Viewer

Length: 323 bp
tcattgttattatttcaaatcaggagcaaaaatcagtcaaagaggagcctgcttctgaaagtagtgtgcctgcaaaaggtagtgctgtatcctcgaaaacgggttcaacaccatctggtggtcctacaggtcccgtatctgaggaagaaattagggcagttttgatgcaaaagtcacccatcaccacacgtgatcttgttaataacttccccggacgactcaaatccaaagaggagaaggatgcttttgcagcaatcctgaggaaaatgtctaggatacagaagaacaacgggatcagctatgttgtattgagggagaagtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0003674 GO:0005488 GO:0005515 GO:0008022
KEGG Pathways
Metabolic & Signaling
ko03022 map03022
Pfam Domains
Protein Families
TFIIF_alpha

Protein Analysis

106

Amino Acids

11.44

Weight (kDa)

9.7

Isoelectric Point (pI)

59.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0023043)

Species Orthologous Gene IDs
rosa_multiflora Rmu_co8174024.1_g000001 Rmu_sc0000405.1_g000010 Rmu_sc0001403.1_g000035 Rmu_sc0003131.1_g000006

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 118
AclWI GGATC 1 cut(s) 301
AcvI CACGTG 1 cut(s) 190
AfiI CCNNNNNNNGG 2 cut(s) 76, 118
AflIII ACRYGT 1 cut(s) 187
AgsI TTSAA 2 cut(s) 17, 107
AluBI AGCT 1 cut(s) 299
AluI AGCT 1 cut(s) 299
AlwI GGATC 1 cut(s) 301
ApeKI GCWGC 1 cut(s) 250
AspS9I GGNCC 2 cut(s) 121, 130
AsuC2I CCSGG 1 cut(s) 212
AsuHPI GGTGA 2 cut(s) 167, 174
AvaII GGWCC 2 cut(s) 121, 130
AxyI CCTNAGG 1 cut(s) 259
BbrPI CACGTG 1 cut(s) 190
BbvI GCAGC 1 cut(s) 262
BccI CCATC 2 cut(s) 120, 187
BciVI GTATCC 2 cut(s) 99, 269
BcnI CCSGG 1 cut(s) 212
BfaI CTAG 1 cut(s) 272
BfmI CTRYAG 1 cut(s) 125
BfuI GTATCC 2 cut(s) 99, 269
BisI GCNGC 1 cut(s) 251
BlsI GCNGC 1 cut(s) 252
Bme1390I CCNGG 1 cut(s) 212
Bme18I GGWCC 2 cut(s) 121, 130
BmgT120I GGNCC 2 cut(s) 121, 130
BmiI GGNNCC 2 cut(s) 47, 132
BmrFI CCNGG 1 cut(s) 212
BmsI GCATC 2 cut(s) 155, 231
BpuMI CCSGG 1 cut(s) 212
BsaAI YACGTR 1 cut(s) 190
BsaJI CCNNGG 1 cut(s) 210
Bsc4I CCNNNNNNNGG 2 cut(s) 76, 118
Bse21I CCTNAGG 1 cut(s) 259
BseDI CCNNGG 1 cut(s) 210
BseGI GGATG 1 cut(s) 246
BseLI CCNNNNNNNGG 2 cut(s) 76, 118
BseMII CTCAG 2 cut(s) 131, 250
BseRI GAGGAG 2 cut(s) 58, 247
BseXI GCAGC 1 cut(s) 262
BsiSI CCGG 1 cut(s) 212
BslFI GGGAC 1 cut(s) 116
BslI CCNNNNNNNGG 2 cut(s) 76, 118
BsmFI GGGAC 1 cut(s) 116
Bsp143I GATC 2 cut(s) 192, 293
BspCNI CTCAG 2 cut(s) 132, 251
BspLI GGNNCC 2 cut(s) 47, 132
BspPI GGATC 1 cut(s) 301
BssECI CCNNGG 1 cut(s) 210
BssMI GATC 2 cut(s) 192, 293
BstBAI YACGTR 1 cut(s) 190
BstC8I GCNNGC 2 cut(s) 50, 71
BstDEI CTNAG 2 cut(s) 140, 259
BstENI CCTNNNNNAGG 1 cut(s) 74
BstF5I GGATG 1 cut(s) 246
BstKTI GATC 2 cut(s) 195, 296
BstMBI GATC 2 cut(s) 192, 293
BstMWI GCNNNNNNNGC 1 cut(s) 250
BstSCI CCNGG 1 cut(s) 210
BstSFI CTRYAG 1 cut(s) 125
BstV1I GCAGC 1 cut(s) 262
Bsu36I CCTNAGG 1 cut(s) 259
BsuI GTATCC 2 cut(s) 99, 269
BtsCI GGATG 1 cut(s) 246
Cac8I GCNNGC 2 cut(s) 50, 71
Cfr13I GGNCC 2 cut(s) 121, 130
CviJI RGCY 2 cut(s) 48, 299
CviKI_1 RGCY 2 cut(s) 48, 299
DdeI CTNAG 2 cut(s) 140, 259
DpnI GATC 2 cut(s) 194, 295
DpnII GATC 2 cut(s) 192, 293
Eco47I GGWCC 2 cut(s) 121, 130
Eco72I CACGTG 1 cut(s) 190
Eco81I CCTNAGG 1 cut(s) 259
EcoNI CCTNNNNNAGG 1 cut(s) 74
EcoO109I RGGNCCY 1 cut(s) 130
FaiI YATR 1 cut(s) 302
FaqI GGGAC 1 cut(s) 116
Fnu4HI GCNGC 1 cut(s) 251
FokI GGATG 1 cut(s) 253
Fsp4HI GCNGC 1 cut(s) 251
FspBI CTAG 1 cut(s) 272
GluI GCNGC 1 cut(s) 251
HapII CCGG 1 cut(s) 212
HinfI GANTC 1 cut(s) 218
HpaII CCGG 1 cut(s) 212
HphI GGTGA 2 cut(s) 167, 174
Hpy188I TCNGA 2 cut(s) 57, 141
Hpy188III TCNNGA 2 cut(s) 22, 258
HpyAV CCTTC 1 cut(s) 231
HpyCH4IV ACGT 1 cut(s) 189
HpyCH4V TGCA 3 cut(s) 73, 168, 250
HpyF10VI GCNNNNNNNGC 1 cut(s) 250
HpyF3I CTNAG 2 cut(s) 140, 259
HpySE526I ACGT 1 cut(s) 189
Kzo9I GATC 2 cut(s) 192, 293
LmnI GCTCC 2 cut(s) 24, 45
LpnPI CCDG 7 cut(s) 7, 62, 83, 101, 113, 225, 271
Lsp1109I GCAGC 1 cut(s) 262
LweI GCATC 2 cut(s) 155, 231
MaeI CTAG 1 cut(s) 272
MaeII ACGT 1 cut(s) 189
MaeIII GTNAC 1 cut(s) 173
MalI GATC 2 cut(s) 194, 295
MboI GATC 2 cut(s) 192, 293
MboII GAAGA 2 cut(s) 157, 294
MluCI AATT 1 cut(s) 149
MlyI GAGTC 1 cut(s) 212
MnlI CCTC 6 cut(s) 36, 102, 135, 225, 254, 305
MseI TTAA 1 cut(s) 200
MspI CCGG 1 cut(s) 212
MspR9I CCNGG 1 cut(s) 212
MwoI GCNNNNNNNGC 1 cut(s) 250
NciI CCSGG 1 cut(s) 212
NdeII GATC 2 cut(s) 192, 293
NlaIV GGNNCC 2 cut(s) 47, 132
NmuCI GTSAC 1 cut(s) 173
PflMI CCANNNNNTGG 1 cut(s) 118
PkrI GCNGC 1 cut(s) 252
PleI GAGTC 1 cut(s) 212
PmaCI CACGTG 1 cut(s) 190
PmlI CACGTG 1 cut(s) 190
PpsI GAGTC 1 cut(s) 212
Ppu21I YACGTR 1 cut(s) 190
PpuMI RGGWCCY 1 cut(s) 130
Psp5II RGGWCCY 1 cut(s) 130
PspCI CACGTG 1 cut(s) 190
PspN4I GGNNCC 2 cut(s) 47, 132
PspPI GGNCC 2 cut(s) 121, 130
PspPPI RGGWCCY 1 cut(s) 130
SaqAI TTAA 1 cut(s) 200
SatI GCNGC 1 cut(s) 251
Sau3AI GATC 2 cut(s) 192, 293
Sau96I GGNCC 2 cut(s) 121, 130
SchI GAGTC 1 cut(s) 212
ScrFI CCNGG 1 cut(s) 212
SetI ASST 4 cut(s) 81, 132, 192, 301
SfaNI GCATC 2 cut(s) 155, 231
SfcI CTRYAG 1 cut(s) 125
SinI GGWCC 2 cut(s) 121, 130
Sse9I AATT 1 cut(s) 149
SspMI CTAG 1 cut(s) 272
StyD4I CCNGG 1 cut(s) 210
TaiI ACGT 1 cut(s) 192
TaqI TCGA 1 cut(s) 94
TasI AATT 1 cut(s) 149
Tru1I TTAA 1 cut(s) 200
Tru9I TTAA 1 cut(s) 200
TseFI GTSAC 1 cut(s) 173
TseI GCWGC 1 cut(s) 250
Tsp45I GTSAC 1 cut(s) 173
Van91I CCANNNNNTGG 1 cut(s) 118
VpaK11BI GGWCC 2 cut(s) 121, 130
XagI CCTNNNNNAGG 1 cut(s) 74
XspI CTAG 1 cut(s) 272
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.