Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8187416.1

Orthogroup ID

OG0031078

Physical Location & Seq

Genomic Coordinates Forward (+)

72 .. 614

Gene Structure 543 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8187416.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 543 bp

atgactgacatgaggatgaggcatgacaaaaaatcaggctatcctgggcgcacttacagattctacacaggcgaaagagtgtttgatttcggttatggcctcagctactccaactacgcttatcactttgtatcttcattaacccaaaagaacctctacctaaatgagtcatcggttggtctaccagctaagaattcggactctagacgctaccagttagtttcagatctaggtgaagaattctgtcagaagaatttgttcaaggtcactgtcagggctaagaatgacggagagatggctggtaagcatccagtgttgctatttgtaagtcagaaaaatccgtcaaatggaagtccaataaaacagttggttggattcaaaagcgtgatactaagcgccggggaaaaagctgaatttgaattcatgctgaacccttgtgagcatttcagccatgcaaatgaggatggatcgatggtggtagaagaaggttctcgtttcttggttgtgggtgatgtagagcaccctattcatgtcatagtttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005576 GO:0005618 GO:0005622 GO:0005623 GO:0005737 GO:0005911 GO:0009505 GO:0009506 GO:0009507 GO:0009536 GO:0030054 GO:0030312 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464 GO:0048046 GO:0055044 GO:0071944

KEGG Pathways

Metabolic & Signaling

ko00520 ko01100 map00520 map01100

Pfam Domains

Protein Families

Fn3-like Glyco_hydro_3 Glyco_hydro_3_C

Protein Analysis

180

Amino Acids

20.36

Weight (kDa)

7.06

Isoelectric Point (pI)

24.59

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0031078)

Species	Orthologous Gene IDs
rosa_multiflora	Rmu_co8187416.1_g000001 Rmu_sc0000540.1_g000067

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	181
AclWI	GGATC	1 cut(s)	475
AcsI	RAATTY	5 cut(s)	193, 239, 253, 413, 419
AfiI	CCNNNNNNNGG	1 cut(s)	347
AgsI	TTSAA	3 cut(s)	262, 379, 419
AjnI	CCWGG	1 cut(s)	43
AluBI	AGCT	3 cut(s)	105, 188, 410
AluI	AGCT	3 cut(s)	105, 188, 410
Alw21I	GWGCWC	1 cut(s)	522
AlwI	GGATC	1 cut(s)	475
AoxI	GGCC	1 cut(s)	97
ApoI	RAATTY	5 cut(s)	193, 239, 253, 413, 419
Asp700I	GAANNNNTTC	1 cut(s)	257
AspLEI	GCGC	2 cut(s)	51, 398
AsuC2I	CCSGG	1 cut(s)	400
AsuHPI	GGTGA	2 cut(s)	245, 521
Bbv12I	GWGCWC	1 cut(s)	522
BbvCI	CCTCAGC	1 cut(s)	101
BccI	CCATC	3 cut(s)	289, 458, 466
BciT130I	CCWGG	1 cut(s)	45
BcnI	CCSGG	1 cut(s)	400
BfaI	CTAG	2 cut(s)	204, 230
BfoI	RGCGCY	1 cut(s)	399
BglII	AGATCT	1 cut(s)	226
Bme1390I	CCNGG	2 cut(s)	45, 400
BmrFI	CCNGG	2 cut(s)	45, 400
BmsI	GCATC	1 cut(s)	316
Bpu10I	CCTNAGC	1 cut(s)	101
BpuMI	CCSGG	1 cut(s)	400
Bsa29I	ATCGAT	1 cut(s)	470
BsaJI	CCNNGG	2 cut(s)	44, 399
Bsc4I	CCNNNNNNNGG	1 cut(s)	347
Bse1I	ACTGG	2 cut(s)	214, 311
BseBI	CCWGG	1 cut(s)	45
BseCI	ATCGAT	1 cut(s)	470
BseDI	CCNNGG	2 cut(s)	44, 399
BseGI	GGATG	3 cut(s)	21, 307, 469
BseLI	CCNNNNNNNGG	1 cut(s)	347
BseMII	CTCAG	1 cut(s)	115
BseNI	ACTGG	2 cut(s)	214, 311
BshFI	GGCC	1 cut(s)	99
BshVI	ATCGAT	1 cut(s)	470
BsiHKAI	GWGCWC	1 cut(s)	522
BsiSI	CCGG	1 cut(s)	399
BslI	CCNNNNNNNGG	1 cut(s)	347
BsnI	GGCC	1 cut(s)	99
Bsp1286I	GDGCHC	1 cut(s)	522
Bsp143I	GATC	2 cut(s)	226, 467
BspANI	GGCC	1 cut(s)	99
BspCNI	CTCAG	1 cut(s)	114
BspDI	ATCGAT	1 cut(s)	470
BspPI	GGATC	1 cut(s)	475
BsrI	ACTGG	2 cut(s)	214, 311
BssECI	CCNNGG	2 cut(s)	44, 399
BssMI	GATC	2 cut(s)	226, 467
Bst2UI	CCWGG	1 cut(s)	45
Bst4CI	ACNGT	2 cut(s)	271, 366
BstDEI	CTNAG	4 cut(s)	101, 189, 279, 392
BstF5I	GGATG	3 cut(s)	21, 307, 469
BstH2I	RGCGCY	1 cut(s)	399
BstHHI	GCGC	2 cut(s)	51, 398
BstKTI	GATC	2 cut(s)	229, 470
BstMBI	GATC	2 cut(s)	226, 467
BstNI	CCWGG	1 cut(s)	45
BstSCI	CCNGG	2 cut(s)	43, 398
BstX2I	RGATCY	1 cut(s)	226
BstYI	RGATCY	1 cut(s)	226
Bsu15I	ATCGAT	1 cut(s)	470
BsuRI	GGCC	1 cut(s)	99
BsuTUI	ATCGAT	1 cut(s)	470
BtsCI	GGATG	3 cut(s)	21, 307, 469
BtsIMutI	CAGTG	2 cut(s)	267, 318
CfoI	GCGC	2 cut(s)	51, 398
ClaI	ATCGAT	1 cut(s)	470
CseI	GACGC	1 cut(s)	216
CviAII	CATG	5 cut(s)	10, 23, 424, 452, 530
CviJI	RGCY	8 cut(s)	39, 99, 105, 188, 278, 299, 410, 450
CviKI_1	RGCY	8 cut(s)	39, 99, 105, 188, 278, 299, 410, 450
DdeI	CTNAG	4 cut(s)	101, 189, 279, 392
DpnI	GATC	2 cut(s)	228, 469
DpnII	GATC	2 cut(s)	226, 467
EcoRI	GAATTC	3 cut(s)	193, 239, 419
EcoRII	CCWGG	1 cut(s)	43
FaeI	CATG	5 cut(s)	13, 26, 427, 455, 533
FaiI	YATR	7 cut(s)	11, 24, 96, 425, 453, 531, 536
FatI	CATG	5 cut(s)	9, 22, 423, 451, 529
FblI	GTMKAC	1 cut(s)	181
FokI	GGATG	3 cut(s)	28, 294, 476
FspBI	CTAG	2 cut(s)	204, 230
GlaI	GCGC	2 cut(s)	50, 397
HaeII	RGCGCY	1 cut(s)	399
HaeIII	GGCC	1 cut(s)	99
HapII	CCGG	1 cut(s)	399
HgaI	GACGC	1 cut(s)	216
HhaI	GCGC	2 cut(s)	51, 398
Hin1II	CATG	5 cut(s)	13, 26, 427, 455, 533
Hin6I	GCGC	2 cut(s)	49, 396
HinP1I	GCGC	2 cut(s)	49, 396
HinfI	GANTC	4 cut(s)	60, 167, 200, 375
HpaII	CCGG	1 cut(s)	399
HphI	GGTGA	2 cut(s)	245, 521
Hpy166II	GTNNAC	1 cut(s)	182
Hpy188I	TCNGA	4 cut(s)	199, 226, 249, 333
Hpy188III	TCNNGA	1 cut(s)	204
Hpy8I	GTNNAC	1 cut(s)	182
HpyAV	CCTTC	1 cut(s)	479
HpyCH4III	ACNGT	2 cut(s)	271, 366
HpyCH4V	TGCA	1 cut(s)	455
HpyF3I	CTNAG	4 cut(s)	101, 189, 279, 392
Hsp92II	CATG	5 cut(s)	13, 26, 427, 455, 533
HspAI	GCGC	2 cut(s)	49, 396
Kzo9I	GATC	2 cut(s)	226, 467
LweI	GCATC	1 cut(s)	316
MaeI	CTAG	2 cut(s)	204, 230
MaeIII	GTNAC	1 cut(s)	265
MalI	GATC	2 cut(s)	228, 469
MboI	GATC	2 cut(s)	226, 467
MboII	GAAGA	4 cut(s)	126, 248, 262, 494
MflI	RGATCY	1 cut(s)	226
MhlI	GDGCHC	1 cut(s)	522
MluCI	AATT	5 cut(s)	193, 239, 253, 413, 419
MlyI	GAGTC	2 cut(s)	176, 194
MmeI	TCCRAC	2 cut(s)	135, 352
MnlI	CCTC	5 cut(s)	6, 12, 110, 164, 454
MroXI	GAANNNNTTC	1 cut(s)	257
MseI	TTAA	1 cut(s)	140
MslI	CAYNNNNRTG	2 cut(s)	14, 456
MspI	CCGG	1 cut(s)	399
MspR9I	CCNGG	2 cut(s)	45, 400
MvaI	CCWGG	1 cut(s)	45
NciI	CCSGG	1 cut(s)	400
NdeII	GATC	2 cut(s)	226, 467
NlaIII	CATG	5 cut(s)	13, 26, 427, 455, 533
NmuCI	GTSAC	1 cut(s)	265
PdmI	GAANNNNTTC	1 cut(s)	257
PfeI	GAWTC	2 cut(s)	60, 375
PleI	GAGTC	2 cut(s)	175, 194
PpsI	GAGTC	2 cut(s)	175, 194
Psp6I	CCWGG	1 cut(s)	43
PspGI	CCWGG	1 cut(s)	43
PsuI	RGATCY	1 cut(s)	226
RseI	CAYNNNNRTG	2 cut(s)	14, 456
SaqAI	TTAA	1 cut(s)	140
Sau3AI	GATC	2 cut(s)	226, 467
SchI	GAGTC	2 cut(s)	176, 194
ScrFI	CCNGG	2 cut(s)	45, 400
SduI	GDGCHC	1 cut(s)	522
SetI	ASST	8 cut(s)	107, 156, 162, 190, 235, 267, 412, 490
SfaNI	GCATC	1 cut(s)	316
SmiMI	CAYNNNNRTG	2 cut(s)	14, 456
Sse9I	AATT	5 cut(s)	193, 239, 253, 413, 419
SspMI	CTAG	2 cut(s)	204, 230
StyD4I	CCNGG	2 cut(s)	43, 398
TaaI	ACNGT	2 cut(s)	271, 366
TaqI	TCGA	1 cut(s)	470
TasI	AATT	5 cut(s)	193, 239, 253, 413, 419
TfiI	GAWTC	2 cut(s)	60, 375
Tru1I	TTAA	1 cut(s)	140
Tru9I	TTAA	1 cut(s)	140
TscAI	CASTG	2 cut(s)	274, 318
TseFI	GTSAC	1 cut(s)	265
Tsp45I	GTSAC	1 cut(s)	265
TspDTI	ATGAA	3 cut(s)	126, 412, 518
TspGWI	ACGGA	2 cut(s)	303, 330
TspRI	CASTG	2 cut(s)	274, 318
XapI	RAATTY	5 cut(s)	193, 239, 253, 413, 419
XbaI	TCTAGA	1 cut(s)	203
XmiI	GTMKAC	1 cut(s)	181
XmnI	GAANNNNTTC	1 cut(s)	257
XspI	CTAG	2 cut(s)	204, 230

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.