Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8234477.1

Orthogroup ID

OG0024696

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 530

Gene Structure 530 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8234477.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 375 bp

tcacacctgttttgggttgatgatcaggatggtgttaaagatggagaaagggtcttgctttgtttaaagcgtgccttgagaattgcaaatgctgctcaacaaatggccagtgtaactcggggtagcagtggaccagtgacactctttgttgaaatactaaacaagtacctctacttttttgagaaaggaaacccccagattaccagtgctgcaattcagggattggtggagttaattacaaccgagttgcaaagtgactctagtaatgtgaaaccagcctctgatgcattttttgccagcacactgcggtacatacagttccaaaaacagaaaggcggggcaatgggtgaaaaatatgcatctatcaaggtgtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0005215 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005768 GO:0005770 GO:0006810 GO:0006886 GO:0008104 GO:0008150 GO:0008565 GO:0012505 GO:0015031 GO:0015833 GO:0016020 GO:0016192 GO:0016197 GO:0016482 GO:0030904 GO:0031410 GO:0031982 GO:0032991 GO:0033036 GO:0034613 GO:0042147 GO:0042886 GO:0043226 GO:0043227 GO:0043229 GO:0044424 GO:0044425 GO:0044444 GO:0044464 GO:0045184 GO:0046907 GO:0051179 GO:0051234 GO:0051641 GO:0051649 GO:0070727 GO:0071702 GO:0071705 GO:0097708 GO:0098796

KEGG Pathways

Metabolic & Signaling

ko04144 map04144

Pfam Domains

Protein Families

Vps35

Protein Analysis

124

Amino Acids

13.66

Weight (kDa)

8.73

Isoelectric Point (pI)

35.7

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0024696)

Species	Orthologous Gene IDs
pyrus_communis	pycom15g00850
rosa_multiflora	Rmu_co8234477.1_g000001 Rmu_sc0036924.1_g000004

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	2 cut(s)	307, 336
AcoI	YGGCCR	1 cut(s)	105
AfaI	GTAC	2 cut(s)	167, 311
AfiI	CCNNNNNNNGG	1 cut(s)	13
AgsI	TTSAA	1 cut(s)	152
AlwNI	CAGNNNCTG	1 cut(s)	281
Ama87I	CYCGRG	1 cut(s)	117
AoxI	GGCC	1 cut(s)	105
ApeKI	GCWGC	2 cut(s)	92, 209
AspS9I	GGNCC	1 cut(s)	131
AsuHPI	GGTGA	1 cut(s)	359
AvaI	CYCGRG	1 cut(s)	117
AvaII	GGWCC	1 cut(s)	131
BalI	TGGCCA	1 cut(s)	107
BbvI	GCAGC	2 cut(s)	79, 196
BccI	CCATC	2 cut(s)	23, 35
BclI	TGATCA	1 cut(s)	22
BfaI	CTAG	1 cut(s)	261
BisI	GCNGC	2 cut(s)	93, 210
BlsI	GCNGC	2 cut(s)	94, 211
Bme18I	GGWCC	1 cut(s)	131
BmeT110I	CYCGRG	1 cut(s)	117
BmgT120I	GGNCC	1 cut(s)	131
BmsI	GCATC	2 cut(s)	274, 368
BpuEI	CTTGAG	1 cut(s)	97
BsaXI	ACNNNNNCTCC	2 cut(s)	36, 66
Bsc4I	CCNNNNNNNGG	1 cut(s)	13
Bse1I	ACTGG	3 cut(s)	108, 134, 204
Bse3DI	GCAATG	1 cut(s)	348
BseGI	GGATG	1 cut(s)	34
BseLI	CCNNNNNNNGG	1 cut(s)	13
BseMI	GCAATG	1 cut(s)	348
BseNI	ACTGG	3 cut(s)	108, 134, 204
BseXI	GCAGC	2 cut(s)	79, 196
BshFI	GGCC	1 cut(s)	107
BsiHKCI	CYCGRG	1 cut(s)	117
BslI	CCNNNNNNNGG	1 cut(s)	13
BsnI	GGCC	1 cut(s)	107
BsoBI	CYCGRG	1 cut(s)	117
Bsp143I	GATC	1 cut(s)	22
BspACI	CCGC	2 cut(s)	307, 336
BspANI	GGCC	1 cut(s)	107
BsrDI	GCAATG	1 cut(s)	348
BsrI	ACTGG	3 cut(s)	108, 134, 204
BssMI	GATC	1 cut(s)	22
Bst4CI	ACNGT	1 cut(s)	318
BstAPI	GCANNNNNTGC	2 cut(s)	92, 293
BstC8I	GCNNGC	2 cut(s)	72, 298
BstF5I	GGATG	1 cut(s)	34
BstKTI	GATC	1 cut(s)	25
BstMBI	GATC	1 cut(s)	22
BstMWI	GCNNNNNNNGC	3 cut(s)	92, 284, 293
BstV1I	GCAGC	2 cut(s)	79, 196
BsuRI	GGCC	1 cut(s)	107
BtsCI	GGATG	1 cut(s)	34
BtsI	GCAGTG	2 cut(s)	133, 302
BtsIMutI	CAGTG	5 cut(s)	115, 133, 141, 211, 302
Cac8I	GCNNGC	2 cut(s)	72, 298
CaiI	CAGNNNCTG	1 cut(s)	281
Cfr13I	GGNCC	1 cut(s)	131
Csp6I	GTAC	2 cut(s)	166, 310
CviJI	RGCY	2 cut(s)	107, 278
CviKI_1	RGCY	2 cut(s)	107, 278
CviQI	GTAC	2 cut(s)	166, 310
DpnI	GATC	1 cut(s)	24
DpnII	GATC	1 cut(s)	22
DraI	TTTAAA	1 cut(s)	66
EaeI	YGGCCR	1 cut(s)	105
Eco47I	GGWCC	1 cut(s)	131
Eco88I	CYCGRG	1 cut(s)	117
EcoT22I	ATGCAT	2 cut(s)	289, 361
FaiI	YATR	2 cut(s)	314, 357
FalI	AAGNNNNNCTT	2 cut(s)	59, 91
FauI	CCCGC	1 cut(s)	329
FbaI	TGATCA	1 cut(s)	22
Fnu4HI	GCNGC	2 cut(s)	93, 210
FokI	GGATG	1 cut(s)	41
Fsp4HI	GCNGC	2 cut(s)	93, 210
FspBI	CTAG	1 cut(s)	261
GluI	GCNGC	2 cut(s)	93, 210
HaeIII	GGCC	1 cut(s)	107
HinfI	GANTC	1 cut(s)	257
HphI	GGTGA	1 cut(s)	359
Hpy166II	GTNNAC	1 cut(s)	131
Hpy188I	TCNGA	1 cut(s)	283
Hpy188III	TCNNGA	1 cut(s)	26
Hpy8I	GTNNAC	1 cut(s)	131
HpyCH4III	ACNGT	1 cut(s)	318
HpyCH4V	TGCA	5 cut(s)	86, 212, 250, 287, 359
HpyF10VI	GCNNNNNNNGC	3 cut(s)	92, 284, 293
Ksp22I	TGATCA	1 cut(s)	22
Kzo9I	GATC	1 cut(s)	22
LpnPI	CCDG	9 cut(s)	11, 20, 121, 147, 203, 209, 217, 288, 310
Lsp1109I	GCAGC	2 cut(s)	79, 196
LweI	GCATC	2 cut(s)	274, 368
MaeI	CTAG	1 cut(s)	261
MaeIII	GTNAC	3 cut(s)	112, 136, 254
MalI	GATC	1 cut(s)	24
MboI	GATC	1 cut(s)	22
MlsI	TGGCCA	1 cut(s)	107
MluCI	AATT	3 cut(s)	81, 213, 234
MluNI	TGGCCA	1 cut(s)	107
MlyI	GAGTC	1 cut(s)	251
MnlI	CCTC	2 cut(s)	179, 289
Mox20I	TGGCCA	1 cut(s)	107
Mph1103I	ATGCAT	2 cut(s)	289, 361
MscI	TGGCCA	1 cut(s)	107
MseI	TTAA	3 cut(s)	36, 65, 233
Msp20I	TGGCCA	1 cut(s)	107
MwoI	GCNNNNNNNGC	3 cut(s)	92, 284, 293
NdeII	GATC	1 cut(s)	22
NmuCI	GTSAC	2 cut(s)	136, 254
NsiI	ATGCAT	2 cut(s)	289, 361
PkrI	GCNGC	2 cut(s)	94, 211
PleI	GAGTC	1 cut(s)	251
PpsI	GAGTC	1 cut(s)	251
PspPI	GGNCC	1 cut(s)	131
PsrI	GAACNNNNNNTAC	2 cut(s)	302, 334
PstNI	CAGNNNCTG	1 cut(s)	281
RsaI	GTAC	2 cut(s)	167, 311
RsaNI	GTAC	2 cut(s)	166, 310
SaqAI	TTAA	3 cut(s)	36, 65, 233
SatI	GCNGC	2 cut(s)	93, 210
Sau3AI	GATC	1 cut(s)	22
Sau96I	GGNCC	1 cut(s)	131
SchI	GAGTC	1 cut(s)	251
SetI	ASST	3 cut(s)	9, 171, 372
SfaNI	GCATC	2 cut(s)	274, 368
SinI	GGWCC	1 cut(s)	131
SmlI	CTYRAG	1 cut(s)	76
SmoI	CTYRAG	1 cut(s)	76
Sse9I	AATT	3 cut(s)	81, 213, 234
SsiI	CCGC	2 cut(s)	307, 336
SspMI	CTAG	1 cut(s)	261
TaaI	ACNGT	1 cut(s)	318
TasI	AATT	3 cut(s)	81, 213, 234
Tru1I	TTAA	3 cut(s)	36, 65, 233
Tru9I	TTAA	3 cut(s)	36, 65, 233
TscAI	CASTG	5 cut(s)	115, 133, 141, 211, 309
TseFI	GTSAC	2 cut(s)	136, 254
TseI	GCWGC	2 cut(s)	92, 209
Tsp45I	GTSAC	2 cut(s)	136, 254
TspRI	CASTG	5 cut(s)	115, 133, 141, 211, 309
VpaK11BI	GGWCC	1 cut(s)	131
XspI	CTAG	1 cut(s)	261
Zsp2I	ATGCAT	2 cut(s)	289, 361

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.