Rmu_co8240307.1_g000001

E3 ubiquitin-protein ligase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8240307.1
Physical Location & Seq
Reverse (-)
1 .. 760
760 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8240307.1_g000001.1.cds

Sequence Viewer

Length: 378 bp
atgctaataagttctttggttgaaggttcgaggtcatttggtcggaaaagcttgcatcacattggaactggtcaaaatccctatgaacaagcaatatcgattatcgggaagacattgtccgcttttgatgaagataatctaattccatgctatgggtttggagatgcatctacacatgatcaagatgtcttcagcttctatccagatgactgcgtttgtactggattcgaggaagtgctgacacgatatagagaaattgttccaactcttcgacttgcaggacctacatcttttgcacccattattgagatggcaatcactattgttgagcaaagtggaggccaataccatgttttgctgatcattgccgatggtcag

Protein Analysis

126

Amino Acids

13.8

Weight (kDa)

4.6

Isoelectric Point (pI)

41.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024268)

Species Orthologous Gene IDs
malus_domestica MD14G1024200.v1.1
pyrus_communis pycom14g02350
rosa_multiflora Rmu_co8240307.1_g000001

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 152
AciI CCGC 1 cut(s) 120
AcuI CTGAAG 1 cut(s) 175
AfaI GTAC 1 cut(s) 220
AfiI CCNNNNNNNGG 1 cut(s) 152
AgsI TTSAA 1 cut(s) 23
AluBI AGCT 2 cut(s) 51, 195
AluI AGCT 2 cut(s) 51, 195
AoxI GGCC 1 cut(s) 340
Asp700I GAANNNNTTC 1 cut(s) 258
AspS9I GGNCC 1 cut(s) 281
AvaII GGWCC 1 cut(s) 281
BbsI GAAGAC 2 cut(s) 116, 181
BccI CCATC 2 cut(s) 304, 365
BclI TGATCA 2 cut(s) 178, 360
Bme18I GGWCC 1 cut(s) 281
BmgT120I GGNCC 1 cut(s) 281
BmsI GCATC 3 cut(s) 64, 154, 176
BpiI GAAGAC 2 cut(s) 116, 181
Bsa29I ATCGAT 1 cut(s) 98
BsaBI GATNNNNATC 1 cut(s) 314
Bsc4I CCNNNNNNNGG 1 cut(s) 152
Bse1I ACTGG 2 cut(s) 73, 226
Bse3DI GCAATG 1 cut(s) 363
Bse8I GATNNNNATC 1 cut(s) 314
BseCI ATCGAT 1 cut(s) 98
BseJI GATNNNNATC 1 cut(s) 314
BseLI CCNNNNNNNGG 1 cut(s) 152
BseMI GCAATG 1 cut(s) 363
BseNI ACTGG 2 cut(s) 73, 226
BshFI GGCC 1 cut(s) 342
BshVI ATCGAT 1 cut(s) 98
BslI CCNNNNNNNGG 1 cut(s) 152
BsnI GGCC 1 cut(s) 342
Bsp143I GATC 2 cut(s) 178, 360
BspACI CCGC 1 cut(s) 120
BspANI GGCC 1 cut(s) 342
BspDI ATCGAT 1 cut(s) 98
BsrDI GCAATG 1 cut(s) 363
BsrI ACTGG 2 cut(s) 73, 226
BssMI GATC 2 cut(s) 178, 360
Bst6I CTCTTC 1 cut(s) 273
BstC8I GCNNGC 1 cut(s) 53
BstKTI GATC 2 cut(s) 181, 363
BstMBI GATC 2 cut(s) 178, 360
BstV2I GAAGAC 2 cut(s) 116, 181
Bsu15I ATCGAT 1 cut(s) 98
BsuRI GGCC 1 cut(s) 342
BsuTUI ATCGAT 1 cut(s) 98
Cac8I GCNNGC 1 cut(s) 53
Cfr13I GGNCC 1 cut(s) 281
ClaI ATCGAT 1 cut(s) 98
Csp6I GTAC 1 cut(s) 219
CviAII CATG 3 cut(s) 147, 176, 350
CviJI RGCY 3 cut(s) 51, 195, 342
CviKI_1 RGCY 3 cut(s) 51, 195, 342
CviQI GTAC 1 cut(s) 219
DpnI GATC 2 cut(s) 180, 362
DpnII GATC 2 cut(s) 178, 360
Eam1104I CTCTTC 1 cut(s) 273
EarI CTCTTC 1 cut(s) 273
Eco47I GGWCC 1 cut(s) 281
Eco57I CTGAAG 1 cut(s) 175
EcoO109I RGGNCCY 1 cut(s) 281
EcoT22I ATGCAT 1 cut(s) 169
FaeI CATG 3 cut(s) 150, 179, 353
FaiI YATR 6 cut(s) 84, 148, 153, 177, 249, 351
FatI CATG 3 cut(s) 146, 175, 349
FbaI TGATCA 2 cut(s) 178, 360
HaeIII GGCC 1 cut(s) 342
Hin1II CATG 3 cut(s) 150, 179, 353
HindIII AAGCTT 1 cut(s) 49
HinfI GANTC 1 cut(s) 225
Hpy188I TCNGA 1 cut(s) 45
Hpy188III TCNNGA 3 cut(s) 106, 182, 203
HpyAV CCTTC 1 cut(s) 17
HpyCH4V TGCA 4 cut(s) 55, 167, 278, 296
Hsp92II CATG 3 cut(s) 150, 179, 353
Ksp22I TGATCA 2 cut(s) 178, 360
Kzo9I GATC 2 cut(s) 178, 360
LpnPI CCDG 4 cut(s) 54, 207, 216, 264
LweI GCATC 3 cut(s) 64, 154, 176
MalI GATC 2 cut(s) 180, 362
MboI GATC 2 cut(s) 178, 360
MboII GAAGA 4 cut(s) 121, 143, 181, 260
MluCI AATT 2 cut(s) 141, 255
MmeI TCCRAC 2 cut(s) 23, 287
MnlI CCTC 3 cut(s) 24, 223, 332
Mph1103I ATGCAT 1 cut(s) 169
MroXI GAANNNNTTC 1 cut(s) 258
NdeII GATC 2 cut(s) 178, 360
NlaIII CATG 3 cut(s) 150, 179, 353
NsiI ATGCAT 1 cut(s) 169
PdmI GAANNNNTTC 1 cut(s) 258
PfeI GAWTC 1 cut(s) 225
PflFI GACNNNGTC 1 cut(s) 115
PflMI CCANNNNNTGG 1 cut(s) 152
PpuMI RGGWCCY 1 cut(s) 281
Psp5II RGGWCCY 1 cut(s) 281
PspPI GGNCC 1 cut(s) 281
PspPPI RGGWCCY 1 cut(s) 281
PsyI GACNNNGTC 1 cut(s) 115
RsaI GTAC 1 cut(s) 220
RsaNI GTAC 1 cut(s) 219
Sau3AI GATC 2 cut(s) 178, 360
Sau96I GGNCC 1 cut(s) 281
SetI ASST 5 cut(s) 28, 35, 53, 197, 286
SfaNI GCATC 3 cut(s) 64, 154, 176
SinI GGWCC 1 cut(s) 281
Sse9I AATT 2 cut(s) 141, 255
SsiI CCGC 1 cut(s) 120
TaqI TCGA 4 cut(s) 29, 98, 228, 271
TasI AATT 2 cut(s) 141, 255
TatI WGTACW 1 cut(s) 218
TfiI GAWTC 1 cut(s) 225
TspDTI ATGAA 2 cut(s) 99, 144
Tth111I GACNNNGTC 1 cut(s) 115
Van91I CCANNNNNTGG 1 cut(s) 152
VpaK11BI GGWCC 1 cut(s) 281
XcmI CCANNNNNNNNNTGG 1 cut(s) 307
XmnI GAANNNNTTC 1 cut(s) 258
Zsp2I ATGCAT 1 cut(s) 169
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.