Rmu_co8249733.1_g000001
ERF Family

Belongs to the protein kinase superfamily

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8249733.1
Physical Location & Seq
Reverse (-)
346 .. 653
308 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8249733.1_g000001.1.cds

Sequence Viewer

Length: 222 bp
atgcccaggccgttacttaacatgcaaagaatgcagccatctcagggcttgactgcatataatcttgcaacacaggcagggatgggtggtggaatgaatcctggtggtatccccatgcagcgtggtgttggtcaggcccatcaccaacaacagttgagaaggaaagatccaggaatggggatgactggataccctccacagcagaaatcaagacgtttctga

Protein Analysis

73

Amino Acids

8.03

Weight (kDa)

11.89

Isoelectric Point (pI)

53.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0031299)

Species Orthologous Gene IDs
rosa_multiflora Rmu_co8249733.1_g000001 Rmu_sc0004330.1_g000002

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 161
AfiI CCNNNNNNNGG 2 cut(s) 44, 176
AjnI CCWGG 3 cut(s) 5, 100, 169
AlwI GGATC 1 cut(s) 161
AoxI GGCC 2 cut(s) 8, 135
ApeKI GCWGC 2 cut(s) 34, 118
AspS9I GGNCC 1 cut(s) 136
AsuHPI GGTGA 1 cut(s) 134
BbvI GCAGC 2 cut(s) 46, 130
BccI CCATC 3 cut(s) 46, 76, 147
BciT130I CCWGG 3 cut(s) 7, 102, 171
BciVI GTATCC 2 cut(s) 119, 182
BfuI GTATCC 2 cut(s) 119, 182
BisI GCNGC 2 cut(s) 35, 119
BlsI GCNGC 2 cut(s) 36, 120
Bme1390I CCNGG 3 cut(s) 7, 102, 171
BmgT120I GGNCC 1 cut(s) 136
BmrFI CCNGG 3 cut(s) 7, 102, 171
BsaJI CCNNGG 1 cut(s) 5
Bsc4I CCNNNNNNNGG 2 cut(s) 44, 176
Bse1I ACTGG 1 cut(s) 190
BseBI CCWGG 3 cut(s) 7, 102, 171
BseDI CCNNGG 1 cut(s) 5
BseGI GGATG 2 cut(s) 87, 186
BseLI CCNNNNNNNGG 2 cut(s) 44, 176
BseMII CTCAG 1 cut(s) 56
BseNI ACTGG 1 cut(s) 190
BseXI GCAGC 2 cut(s) 46, 130
BshFI GGCC 2 cut(s) 10, 137
BslI CCNNNNNNNGG 2 cut(s) 44, 176
BsmI GAATGC 1 cut(s) 36
BsnI GGCC 2 cut(s) 10, 137
Bsp143I GATC 1 cut(s) 166
BspANI GGCC 2 cut(s) 10, 137
BspCNI CTCAG 1 cut(s) 55
BspPI GGATC 1 cut(s) 161
BsrI ACTGG 1 cut(s) 190
BssECI CCNNGG 1 cut(s) 5
BssMI GATC 1 cut(s) 166
Bst2UI CCWGG 3 cut(s) 7, 102, 171
Bst4CI ACNGT 1 cut(s) 153
BstAPI GCANNNNNTGC 1 cut(s) 31
BstDEI CTNAG 1 cut(s) 42
BstF5I GGATG 2 cut(s) 87, 186
BstKTI GATC 1 cut(s) 169
BstMBI GATC 1 cut(s) 166
BstMWI GCNNNNNNNGC 2 cut(s) 31, 74
BstNI CCWGG 3 cut(s) 7, 102, 171
BstNSI RCATGY 1 cut(s) 25
BstSCI CCNGG 3 cut(s) 5, 100, 169
BstV1I GCAGC 2 cut(s) 46, 130
BstX2I RGATCY 1 cut(s) 166
BstYI RGATCY 1 cut(s) 166
BsuI GTATCC 2 cut(s) 119, 182
BsuRI GGCC 2 cut(s) 10, 137
BtsCI GGATG 2 cut(s) 87, 186
Cfr13I GGNCC 1 cut(s) 136
CviAII CATG 2 cut(s) 22, 115
CviJI RGCY 4 cut(s) 10, 37, 48, 137
CviKI_1 RGCY 4 cut(s) 10, 37, 48, 137
DdeI CTNAG 1 cut(s) 42
DpnI GATC 1 cut(s) 168
DpnII GATC 1 cut(s) 166
EcoRII CCWGG 3 cut(s) 5, 100, 169
FaeI CATG 2 cut(s) 25, 118
FaiI YATR 4 cut(s) 23, 58, 60, 116
FatI CATG 2 cut(s) 21, 114
Fnu4HI GCNGC 2 cut(s) 35, 119
FokI GGATG 2 cut(s) 94, 193
Fsp4HI GCNGC 2 cut(s) 35, 119
GluI GCNGC 2 cut(s) 35, 119
HaeIII GGCC 2 cut(s) 10, 137
Hin1II CATG 2 cut(s) 25, 118
HinfI GANTC 1 cut(s) 97
HphI GGTGA 1 cut(s) 134
Hpy188I TCNGA 1 cut(s) 221
Hpy188III TCNNGA 1 cut(s) 210
HpyAV CCTTC 1 cut(s) 153
HpyCH4III ACNGT 1 cut(s) 153
HpyCH4IV ACGT 1 cut(s) 214
HpyCH4V TGCA 5 cut(s) 25, 34, 56, 68, 118
HpyF10VI GCNNNNNNNGC 2 cut(s) 31, 74
HpyF3I CTNAG 1 cut(s) 42
HpySE526I ACGT 1 cut(s) 214
Hsp92II CATG 2 cut(s) 25, 118
Kzo9I GATC 1 cut(s) 166
Lsp1109I GCAGC 2 cut(s) 46, 130
MaeII ACGT 1 cut(s) 214
MaeIII GTNAC 1 cut(s) 12
MalI GATC 1 cut(s) 168
MboI GATC 1 cut(s) 166
MflI RGATCY 1 cut(s) 166
MnlI CCTC 1 cut(s) 204
MseI TTAA 1 cut(s) 18
MspR9I CCNGG 3 cut(s) 7, 102, 171
Mva1269I GAATGC 1 cut(s) 36
MvaI CCWGG 3 cut(s) 7, 102, 171
MwoI GCNNNNNNNGC 2 cut(s) 31, 74
NdeII GATC 1 cut(s) 166
NlaIII CATG 2 cut(s) 25, 118
NspI RCATGY 1 cut(s) 25
PctI GAATGC 1 cut(s) 36
PfeI GAWTC 1 cut(s) 97
PfoI TCCNGGA 1 cut(s) 169
PkrI GCNGC 2 cut(s) 36, 120
Psp6I CCWGG 3 cut(s) 5, 100, 169
PspGI CCWGG 3 cut(s) 5, 100, 169
PspPI GGNCC 1 cut(s) 136
PsuI RGATCY 1 cut(s) 166
SaqAI TTAA 1 cut(s) 18
SatI GCNGC 2 cut(s) 35, 119
Sau3AI GATC 1 cut(s) 166
Sau96I GGNCC 1 cut(s) 136
ScrFI CCNGG 3 cut(s) 7, 102, 171
SetI ASST 1 cut(s) 217
StyD4I CCNGG 3 cut(s) 5, 100, 169
TaaI ACNGT 1 cut(s) 153
TaiI ACGT 1 cut(s) 217
TfiI GAWTC 1 cut(s) 97
Tru1I TTAA 1 cut(s) 18
Tru9I TTAA 1 cut(s) 18
TseI GCWGC 2 cut(s) 34, 118
TspDTI ATGAA 1 cut(s) 110
XceI RCATGY 1 cut(s) 25
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.