Rmu_co8284871.1_g000001

MORN repeat-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8284871.1
OG0010948
Physical Location & Seq
Forward (+)
1 .. 719
719 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8284871.1_g000001.1.cds

Sequence Viewer

Length: 394 bp
aaatggagatagatatgcaggggagtatttcggagataaaatccatggatttggtatctatcactttgctaatggtcattgttatgaggggtcatggcatgagggccgaaagcaaggctacggcgtttataccttccggagtggcgacacaagatgtggtgtatgggatggtggcacccttaagcaccctcttctgccactaaacgatgcagttgtccgagctgttcaggctgctaggagagcagcacagaatgctgctaacctccggcgggtggatgaacaggtgaacaaggcggtcatggcttcaaatagagctgccactgctgccagagttgctgctgttaaagcggtccaaaaccgaatggatggcaagttttgtgatacaaatgtctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
MORN

Protein Analysis

130

Amino Acids

14.26

Weight (kDa)

9.47

Isoelectric Point (pI)

21.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010948)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G77660
fragaria_vesca FvH4_2g26570 FvH4_2g26570
malus_domestica MD08G1166700.v1.1 MD15G1352900.v1.1
prunus_persica Prupe.1G501200_v2.0.a1
pyrus_communis pycom08g14270 pycom15g31610
rosa_chinensis RchiOBHm_Chr6g0295441
rosa_laevigata RLG00000011802
rosa_multiflora Rmu_co8284871.1_g000001 Rmu_co8418401.1_g000001
rosa_roxburghii Rroxscaffold_7G00172480
rosa_rugosa Rorug06G0250500 Rorug06G0250600
rosa_samantha Rh6AG364100 Rh6BG372300 Rh6CG378700 Rh6DG365100
rosa_wichuraiana Rw6G031790

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 174
AccIII TCCGGA 1 cut(s) 136
AciI CCGC 3 cut(s) 269, 294, 348
AfiI CCNNNNNNNGG 2 cut(s) 269, 272
AflII CTTAAG 1 cut(s) 180
AgsI TTSAA 1 cut(s) 307
AluBI AGCT 2 cut(s) 222, 315
AluI AGCT 2 cut(s) 222, 315
Aor13HI TCCGGA 1 cut(s) 136
AoxI GGCC 1 cut(s) 104
ApeKI GCWGC 6 cut(s) 231, 243, 255, 315, 324, 336
AspS9I GGNCC 2 cut(s) 104, 350
AsuHPI GGTGA 1 cut(s) 296
AvaII GGWCC 1 cut(s) 350
BaeI ACNNNNGTAYC 1 cut(s) 373
BanI GGYRCC 1 cut(s) 174
BbvI GCAGC 6 cut(s) 218, 242, 255, 302, 311, 323
BccI CCATC 2 cut(s) 162, 360
BceAI ACGGC 1 cut(s) 137
BfaI CTAG 1 cut(s) 235
BfrI CTTAAG 1 cut(s) 180
BisI GCNGC 6 cut(s) 232, 244, 256, 316, 325, 337
BlsI GCNGC 6 cut(s) 233, 245, 257, 317, 326, 338
Bme18I GGWCC 1 cut(s) 350
BmgT120I GGNCC 2 cut(s) 104, 350
BmiI GGNNCC 1 cut(s) 176
BmsI GCATC 1 cut(s) 197
BsaJI CCNNGG 1 cut(s) 44
BsaWI WCCGGW 1 cut(s) 136
Bsc4I CCNNNNNNNGG 2 cut(s) 269, 272
BseAI TCCGGA 1 cut(s) 136
BseDI CCNNGG 1 cut(s) 44
BseGI GGATG 3 cut(s) 173, 281, 371
BseLI CCNNNNNNNGG 2 cut(s) 269, 272
BseXI GCAGC 6 cut(s) 218, 242, 255, 302, 311, 323
BshFI GGCC 1 cut(s) 106
BshNI GGYRCC 1 cut(s) 174
BsiSI CCGG 2 cut(s) 137, 266
BslI CCNNNNNNNGG 2 cut(s) 269, 272
BsmI GAATGC 1 cut(s) 257
BsnI GGCC 1 cut(s) 106
Bsp13I TCCGGA 1 cut(s) 136
Bsp19I CCATGG 1 cut(s) 44
BspACI CCGC 3 cut(s) 269, 294, 348
BspANI GGCC 1 cut(s) 106
BspEI TCCGGA 1 cut(s) 136
BspLI GGNNCC 1 cut(s) 176
BspT107I GGYRCC 1 cut(s) 174
BspTI CTTAAG 1 cut(s) 180
BssECI CCNNGG 1 cut(s) 44
BssT1I CCWWGG 1 cut(s) 44
Bst6I CTCTTC 1 cut(s) 196
BstAFI CTTAAG 1 cut(s) 180
BstAPI GCANNNNNTGC 1 cut(s) 252
BstDSI CCRYGG 1 cut(s) 44
BstF5I GGATG 3 cut(s) 173, 281, 371
BstMWI GCNNNNNNNGC 8 cut(s) 228, 240, 252, 300, 321, 324, 333, 345
BstV1I GCAGC 6 cut(s) 218, 242, 255, 302, 311, 323
BstXI CCANNNNNNTGG 1 cut(s) 51
BsuRI GGCC 1 cut(s) 106
BtgI CCRYGG 1 cut(s) 44
BtsCI GGATG 3 cut(s) 173, 281, 371
BtsI GCAGTG 1 cut(s) 319
BtsIMutI CAGTG 1 cut(s) 319
Cfr13I GGNCC 2 cut(s) 104, 350
CviAII CATG 4 cut(s) 45, 94, 99, 299
CviJI RGCY 6 cut(s) 106, 118, 222, 231, 303, 315
CviKI_1 RGCY 6 cut(s) 106, 118, 222, 231, 303, 315
Eam1104I CTCTTC 1 cut(s) 196
EarI CTCTTC 1 cut(s) 196
Eco130I CCWWGG 1 cut(s) 44
Eco47I GGWCC 1 cut(s) 350
EcoT14I CCWWGG 1 cut(s) 44
ErhI CCWWGG 1 cut(s) 44
FaeI CATG 4 cut(s) 48, 97, 102, 302
FaiI YATR 8 cut(s) 16, 46, 85, 95, 100, 130, 164, 300
FatI CATG 4 cut(s) 44, 93, 98, 298
FauI CCCGC 1 cut(s) 262
Fnu4HI GCNGC 6 cut(s) 232, 244, 256, 316, 325, 337
FokI GGATG 3 cut(s) 180, 288, 378
Fsp4HI GCNGC 6 cut(s) 232, 244, 256, 316, 325, 337
FspBI CTAG 1 cut(s) 235
GluI GCNGC 6 cut(s) 232, 244, 256, 316, 325, 337
HaeIII GGCC 1 cut(s) 106
HapII CCGG 2 cut(s) 137, 266
Hin1II CATG 4 cut(s) 48, 97, 102, 302
HpaII CCGG 2 cut(s) 137, 266
HphI GGTGA 1 cut(s) 296
Hpy166II GTNNAC 1 cut(s) 287
Hpy188I TCNGA 3 cut(s) 33, 219, 393
Hpy188III TCNNGA 1 cut(s) 137
Hpy8I GTNNAC 1 cut(s) 287
HpyAV CCTTC 1 cut(s) 143
HpyCH4V TGCA 2 cut(s) 18, 210
HpyF10VI GCNNNNNNNGC 8 cut(s) 228, 240, 252, 300, 321, 324, 333, 345
Hsp92II CATG 4 cut(s) 48, 97, 102, 302
Kpn2I TCCGGA 1 cut(s) 136
LpnPI CCDG 6 cut(s) 4, 150, 213, 267, 279, 341
Lsp1109I GCAGC 6 cut(s) 218, 242, 255, 302, 311, 323
LweI GCATC 1 cut(s) 197
MaeI CTAG 1 cut(s) 235
MboII GAAGA 1 cut(s) 183
MnlI CCTC 4 cut(s) 80, 95, 199, 273
MroI TCCGGA 1 cut(s) 136
MseI TTAA 2 cut(s) 181, 343
MslI CAYNNNNRTG 1 cut(s) 82
MspCI CTTAAG 1 cut(s) 180
MspI CCGG 2 cut(s) 137, 266
Mva1269I GAATGC 1 cut(s) 257
MwoI GCNNNNNNNGC 8 cut(s) 228, 240, 252, 300, 321, 324, 333, 345
NcoI CCATGG 1 cut(s) 44
NlaIII CATG 4 cut(s) 48, 97, 102, 302
NlaIV GGNNCC 1 cut(s) 176
PctI GAATGC 1 cut(s) 257
PkrI GCNGC 6 cut(s) 233, 245, 257, 317, 326, 338
PspN4I GGNNCC 1 cut(s) 176
PspPI GGNCC 2 cut(s) 104, 350
RseI CAYNNNNRTG 1 cut(s) 82
SaqAI TTAA 2 cut(s) 181, 343
SatI GCNGC 6 cut(s) 232, 244, 256, 316, 325, 337
Sau96I GGNCC 2 cut(s) 104, 350
SetI ASST 5 cut(s) 135, 224, 265, 286, 317
SfaNI GCATC 1 cut(s) 197
SinI GGWCC 1 cut(s) 350
SmiMI CAYNNNNRTG 1 cut(s) 82
SmlI CTYRAG 1 cut(s) 180
SmoI CTYRAG 1 cut(s) 180
SsiI CCGC 3 cut(s) 269, 294, 348
SspMI CTAG 1 cut(s) 235
StyI CCWWGG 1 cut(s) 44
Tru1I TTAA 2 cut(s) 181, 343
Tru9I TTAA 2 cut(s) 181, 343
TscAI CASTG 1 cut(s) 326
TseI GCWGC 6 cut(s) 231, 243, 255, 315, 324, 336
TspDTI ATGAA 1 cut(s) 292
TspRI CASTG 1 cut(s) 326
Vha464I CTTAAG 1 cut(s) 180
VpaK11BI GGWCC 1 cut(s) 350
XspI CTAG 1 cut(s) 235
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.