Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8312387.1

Orthogroup ID

OG0029227

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 674

Gene Structure 674 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8312387.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 316 bp

gaaaaaaaggaaagagaaagccatatgggagtcgagaagtaaacaagtaggcaaactcattaatgggaatgcaagcaagcgcagggaacttttggaaaaggaagaccgtttgggggtacaagtacaaggaaaatacaaacaaatggaagactcaaggagggaagaagaatctcgtcagcaagaaatcttaagaggcaaggaggatctagctgctgctgaacgagaacttgagaatctgcctccttctgcactgcccacggatgaacttgtaagttatggattcaatgttcaaaatcttgtgattcttaaatgttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000819 GO:0005575 GO:0005911 GO:0006996 GO:0007049 GO:0007059 GO:0007062 GO:0008150 GO:0009506 GO:0009987 GO:0016043 GO:0022402 GO:0030054 GO:0051276 GO:0055044 GO:0071840 GO:0098813

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

AAA_23 SMC_N

Protein Analysis

104

Amino Acids

12.05

Weight (kDa)

9.07

Isoelectric Point (pI)

68.3

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0029227)

Species	Orthologous Gene IDs
pyrus_communis	pycom02g25430
rosa_multiflora	Rmu_co8312387.1_g000001

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	211
AfaI	GTAC	2 cut(s)	118, 124
AfiI	CCNNNNNNNGG	1 cut(s)	113
AflII	CTTAAG	1 cut(s)	188
AgsI	TTSAA	2 cut(s)	284, 291
AloI	GAACNNNNNNTCC	2 cut(s)	271, 303
AluBI	AGCT	1 cut(s)	210
AluI	AGCT	1 cut(s)	210
AlwI	GGATC	1 cut(s)	211
ApeKI	GCWGC	2 cut(s)	210, 213
AseI	ATTAAT	1 cut(s)	61
AspLEI	GCGC	1 cut(s)	82
BbsI	GAAGAC	2 cut(s)	109, 154
BbvI	GCAGC	2 cut(s)	197, 200
BfaI	CTAG	1 cut(s)	207
BfrI	CTTAAG	1 cut(s)	188
BisI	GCNGC	2 cut(s)	211, 214
BlsI	GCNGC	2 cut(s)	212, 215
BpiI	GAAGAC	2 cut(s)	109, 154
BpuEI	CTTGAG	2 cut(s)	137, 249
BsaJI	CCNNGG	1 cut(s)	256
Bsc4I	CCNNNNNNNGG	1 cut(s)	113
BseDI	CCNNGG	1 cut(s)	256
BseGI	GGATG	1 cut(s)	266
BseLI	CCNNNNNNNGG	1 cut(s)	113
BseXI	GCAGC	2 cut(s)	197, 200
BsgI	GTGCAG	1 cut(s)	232
BslI	CCNNNNNNNGG	1 cut(s)	113
BsmI	GAATGC	1 cut(s)	74
Bsp143I	GATC	1 cut(s)	203
BspPI	GGATC	1 cut(s)	211
BspTI	CTTAAG	1 cut(s)	188
BssECI	CCNNGG	1 cut(s)	256
BssMI	GATC	1 cut(s)	203
Bst4CI	ACNGT	1 cut(s)	108
BstAFI	CTTAAG	1 cut(s)	188
BstC8I	GCNNGC	2 cut(s)	74, 78
BstDSI	CCRYGG	1 cut(s)	256
BstF5I	GGATG	1 cut(s)	266
BstHHI	GCGC	1 cut(s)	82
BstKTI	GATC	1 cut(s)	206
BstMBI	GATC	1 cut(s)	203
BstV1I	GCAGC	2 cut(s)	197, 200
BstV2I	GAAGAC	2 cut(s)	109, 154
BstX2I	RGATCY	1 cut(s)	203
BstYI	RGATCY	1 cut(s)	203
BtgI	CCRYGG	1 cut(s)	256
BtsCI	GGATG	1 cut(s)	266
BtsI	GCAGTG	1 cut(s)	249
BtsIMutI	CAGTG	1 cut(s)	249
Cac8I	GCNNGC	2 cut(s)	74, 78
CfoI	GCGC	1 cut(s)	82
Csp6I	GTAC	2 cut(s)	117, 123
CviJI	RGCY	2 cut(s)	21, 210
CviKI_1	RGCY	2 cut(s)	21, 210
CviQI	GTAC	2 cut(s)	117, 123
DpnI	GATC	1 cut(s)	205
DpnII	GATC	1 cut(s)	203
FaiI	YATR	3 cut(s)	24, 26, 277
FauNDI	CATATG	1 cut(s)	24
Fnu4HI	GCNGC	2 cut(s)	211, 214
FokI	GGATG	1 cut(s)	273
Fsp4HI	GCNGC	2 cut(s)	211, 214
FspBI	CTAG	1 cut(s)	207
GlaI	GCGC	1 cut(s)	81
GluI	GCNGC	2 cut(s)	211, 214
HhaI	GCGC	1 cut(s)	82
Hin6I	GCGC	1 cut(s)	80
HinP1I	GCGC	1 cut(s)	80
HinfI	GANTC	6 cut(s)	30, 150, 168, 233, 280, 302
Hpy166II	GTNNAC	1 cut(s)	42
Hpy188III	TCNNGA	1 cut(s)	34
Hpy8I	GTNNAC	1 cut(s)	42
HpyAV	CCTTC	1 cut(s)	253
HpyCH4III	ACNGT	1 cut(s)	108
HpyCH4V	TGCA	2 cut(s)	72, 249
HspAI	GCGC	1 cut(s)	80
Kzo9I	GATC	1 cut(s)	203
LpnPI	CCDG	1 cut(s)	68
Lsp1109I	GCAGC	2 cut(s)	197, 200
MaeI	CTAG	1 cut(s)	207
MalI	GATC	1 cut(s)	205
MboI	GATC	1 cut(s)	203
MboII	GAAGA	4 cut(s)	114, 159, 174, 177
MflI	RGATCY	1 cut(s)	203
MlyI	GAGTC	2 cut(s)	39, 144
MnlI	CCTC	4 cut(s)	151, 186, 194, 250
MseI	TTAA	4 cut(s)	61, 189, 307, 314
MspCI	CTTAAG	1 cut(s)	188
Mva1269I	GAATGC	1 cut(s)	74
NdeI	CATATG	1 cut(s)	24
NdeII	GATC	1 cut(s)	203
PctI	GAATGC	1 cut(s)	74
PfeI	GAWTC	4 cut(s)	168, 233, 280, 302
PkrI	GCNGC	2 cut(s)	212, 215
PleI	GAGTC	2 cut(s)	38, 144
PpsI	GAGTC	2 cut(s)	38, 144
PshBI	ATTAAT	1 cut(s)	61
PsuI	RGATCY	1 cut(s)	203
RsaI	GTAC	2 cut(s)	118, 124
RsaNI	GTAC	2 cut(s)	117, 123
SaqAI	TTAA	4 cut(s)	61, 189, 307, 314
SatI	GCNGC	2 cut(s)	211, 214
Sau3AI	GATC	1 cut(s)	203
SchI	GAGTC	2 cut(s)	39, 144
SetI	ASST	1 cut(s)	212
SmlI	CTYRAG	3 cut(s)	152, 188, 228
SmoI	CTYRAG	3 cut(s)	152, 188, 228
SspMI	CTAG	1 cut(s)	207
TaaI	ACNGT	1 cut(s)	108
TaqI	TCGA	1 cut(s)	33
TatI	WGTACW	1 cut(s)	122
TfiI	GAWTC	4 cut(s)	168, 233, 280, 302
Tru1I	TTAA	4 cut(s)	61, 189, 307, 314
Tru9I	TTAA	4 cut(s)	61, 189, 307, 314
TscAI	CASTG	1 cut(s)	256
TseI	GCWGC	2 cut(s)	210, 213
TspDTI	ATGAA	1 cut(s)	277
TspGWI	ACGGA	1 cut(s)	273
TspRI	CASTG	1 cut(s)	256
Vha464I	CTTAAG	1 cut(s)	188
VspI	ATTAAT	1 cut(s)	61
XspI	CTAG	1 cut(s)	207

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.