Rmu_co8328269.1_g000001
HSP70 Family

Heat shock 70 kDa protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8328269.1
OG0031602
Physical Location & Seq
Forward (+)
1 .. 912
912 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8328269.1_g000001.1.cds

Sequence Viewer

Length: 348 bp
ctggtagatccaattgaaagccgatataaagatgaggaagcaagagcacaggctactagagatctattaaagtgcattggtgattatcgcatggctgcggattcactttcacccatggataaagaatcgattgttaccgagtgctttaaggtggagcagtggcttagagagaaaaaccaacagcaaaactccatgccaaagaacatggacccaatattatggtcgagtgatattaagagccggactgaggagttgaactcgaaattcaaacacatatttagatccagggcttctcatcgagatgaccacaagggttcaaaccagcatgatacttctagacacaaatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04530 ko04612 map04530 map04612
Pfam Domains
Protein Families
HSP70

Protein Analysis

115

Amino Acids

13.55

Weight (kDa)

7.98

Isoelectric Point (pI)

58.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0031602)

Species Orthologous Gene IDs
rosa_multiflora Rmu_co8328269.1_g000001 Rmu_sc0040929.1_g000001

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 98
AclWI GGATC 2 cut(s) 2, 276
AcsI RAATTY 1 cut(s) 263
AfiI CCNNNNNNNGG 1 cut(s) 247
AgsI TTSAA 4 cut(s) 17, 256, 268, 318
AjnI CCWGG 1 cut(s) 284
Alw21I GWGCWC 1 cut(s) 49
AlwI GGATC 2 cut(s) 2, 276
ApeKI GCWGC 1 cut(s) 95
ApoI RAATTY 1 cut(s) 263
AspS9I GGNCC 1 cut(s) 208
AsuHPI GGTGA 2 cut(s) 92, 102
AvaII GGWCC 1 cut(s) 208
Bbv12I GWGCWC 1 cut(s) 49
BbvI GCAGC 1 cut(s) 82
BciT130I CCWGG 1 cut(s) 286
BfaI CTAG 2 cut(s) 57, 336
BglII AGATCT 1 cut(s) 61
BisI GCNGC 1 cut(s) 96
BlsI GCNGC 1 cut(s) 97
Bme1390I CCNGG 1 cut(s) 286
Bme18I GGWCC 1 cut(s) 208
BmgT120I GGNCC 1 cut(s) 208
BmiI GGNNCC 1 cut(s) 210
BmrFI CCNGG 1 cut(s) 286
BplI GAGNNNNNCTC 2 cut(s) 242, 274
Bsa29I ATCGAT 1 cut(s) 128
BsaJI CCNNGG 2 cut(s) 114, 285
Bsc4I CCNNNNNNNGG 1 cut(s) 247
BseBI CCWGG 1 cut(s) 286
BseCI ATCGAT 1 cut(s) 128
BseDI CCNNGG 2 cut(s) 114, 285
BseLI CCNNNNNNNGG 1 cut(s) 247
BseMII CTCAG 1 cut(s) 237
BseRI GAGGAG 1 cut(s) 263
BseXI GCAGC 1 cut(s) 82
BshVI ATCGAT 1 cut(s) 128
BsiHKAI GWGCWC 1 cut(s) 49
BsiSI CCGG 1 cut(s) 241
BslI CCNNNNNNNGG 1 cut(s) 247
Bsp1286I GDGCHC 1 cut(s) 49
Bsp143I GATC 3 cut(s) 7, 61, 281
Bsp19I CCATGG 1 cut(s) 114
BspACI CCGC 1 cut(s) 98
BspCNI CTCAG 1 cut(s) 238
BspDI ATCGAT 1 cut(s) 128
BspLI GGNNCC 1 cut(s) 210
BspPI GGATC 2 cut(s) 2, 276
BssECI CCNNGG 2 cut(s) 114, 285
BssMI GATC 3 cut(s) 7, 61, 281
BssT1I CCWWGG 1 cut(s) 114
Bst2UI CCWGG 1 cut(s) 286
BstDEI CTNAG 2 cut(s) 164, 246
BstDSI CCRYGG 1 cut(s) 114
BstKTI GATC 3 cut(s) 10, 64, 284
BstMBI GATC 3 cut(s) 7, 61, 281
BstNI CCWGG 1 cut(s) 286
BstSCI CCNGG 1 cut(s) 284
BstV1I GCAGC 1 cut(s) 82
BstX2I RGATCY 3 cut(s) 7, 61, 281
BstXI CCANNNNNNTGG 1 cut(s) 219
BstYI RGATCY 3 cut(s) 7, 61, 281
Bsu15I ATCGAT 1 cut(s) 128
BsuTUI ATCGAT 1 cut(s) 128
BtgI CCRYGG 1 cut(s) 114
BtsI GCAGTG 1 cut(s) 164
BtsIMutI CAGTG 1 cut(s) 164
Cfr13I GGNCC 1 cut(s) 208
ClaI ATCGAT 1 cut(s) 128
CviAII CATG 5 cut(s) 91, 115, 193, 205, 326
CviJI RGCY 6 cut(s) 21, 53, 95, 163, 240, 290
CviKI_1 RGCY 6 cut(s) 21, 53, 95, 163, 240, 290
DdeI CTNAG 2 cut(s) 164, 246
DpnI GATC 3 cut(s) 9, 63, 283
DpnII GATC 3 cut(s) 7, 61, 281
Eco130I CCWWGG 1 cut(s) 114
Eco47I GGWCC 1 cut(s) 208
EcoRII CCWGG 1 cut(s) 284
EcoT14I CCWWGG 1 cut(s) 114
ErhI CCWWGG 1 cut(s) 114
FaeI CATG 5 cut(s) 94, 118, 196, 208, 329
FaiI YATR 8 cut(s) 27, 92, 116, 194, 206, 220, 275, 327
FatI CATG 5 cut(s) 90, 114, 192, 204, 325
Fnu4HI GCNGC 1 cut(s) 96
Fsp4HI GCNGC 1 cut(s) 96
FspBI CTAG 2 cut(s) 57, 336
GluI GCNGC 1 cut(s) 96
HapII CCGG 1 cut(s) 241
Hin1II CATG 5 cut(s) 94, 118, 196, 208, 329
HinfI GANTC 2 cut(s) 101, 125
HpaII CCGG 1 cut(s) 241
HphI GGTGA 2 cut(s) 92, 102
Hpy188III TCNNGA 2 cut(s) 299, 336
HpyCH4V TGCA 1 cut(s) 75
HpyF3I CTNAG 2 cut(s) 164, 246
Hsp92II CATG 5 cut(s) 94, 118, 196, 208, 329
Kzo9I GATC 3 cut(s) 7, 61, 281
LmnI GCTCC 1 cut(s) 154
LpnPI CCDG 5 cut(s) 35, 254, 271, 298, 335
Lsp1109I GCAGC 1 cut(s) 82
MaeI CTAG 2 cut(s) 57, 336
MaeIII GTNAC 1 cut(s) 133
MalI GATC 3 cut(s) 9, 63, 283
MboI GATC 3 cut(s) 7, 61, 281
MfeI CAATTG 1 cut(s) 12
MflI RGATCY 3 cut(s) 7, 61, 281
MhlI GDGCHC 1 cut(s) 49
MluCI AATT 2 cut(s) 12, 263
MnlI CCTC 2 cut(s) 28, 241
MseI TTAA 3 cut(s) 68, 147, 234
MslI CAYNNNNRTG 1 cut(s) 300
MspI CCGG 1 cut(s) 241
MspR9I CCNGG 1 cut(s) 286
MunI CAATTG 1 cut(s) 12
MvaI CCWGG 1 cut(s) 286
NcoI CCATGG 1 cut(s) 114
NdeII GATC 3 cut(s) 7, 61, 281
NlaIII CATG 5 cut(s) 94, 118, 196, 208, 329
NlaIV GGNNCC 1 cut(s) 210
PfeI GAWTC 2 cut(s) 101, 125
PkrI GCNGC 1 cut(s) 97
Psp6I CCWGG 1 cut(s) 284
PspGI CCWGG 1 cut(s) 284
PspN4I GGNNCC 1 cut(s) 210
PspPI GGNCC 1 cut(s) 208
PsuI RGATCY 3 cut(s) 7, 61, 281
RseI CAYNNNNRTG 1 cut(s) 300
SaqAI TTAA 3 cut(s) 68, 147, 234
SatI GCNGC 1 cut(s) 96
Sau3AI GATC 3 cut(s) 7, 61, 281
Sau96I GGNCC 1 cut(s) 208
ScrFI CCNGG 1 cut(s) 286
SduI GDGCHC 1 cut(s) 49
SetI ASST 1 cut(s) 153
SinI GGWCC 1 cut(s) 208
SmiMI CAYNNNNRTG 1 cut(s) 300
Sse9I AATT 2 cut(s) 12, 263
SsiI CCGC 1 cut(s) 98
SspI AATATT 1 cut(s) 216
SspMI CTAG 2 cut(s) 57, 336
StyD4I CCNGG 1 cut(s) 284
StyI CCWWGG 1 cut(s) 114
TaqI TCGA 4 cut(s) 128, 224, 260, 298
TasI AATT 2 cut(s) 12, 263
TfiI GAWTC 2 cut(s) 101, 125
Tru1I TTAA 3 cut(s) 68, 147, 234
Tru9I TTAA 3 cut(s) 68, 147, 234
TscAI CASTG 1 cut(s) 164
TseI GCWGC 1 cut(s) 95
TspRI CASTG 1 cut(s) 164
VpaK11BI GGWCC 1 cut(s) 208
XapI RAATTY 1 cut(s) 263
XbaI TCTAGA 1 cut(s) 335
XspI CTAG 2 cut(s) 57, 336
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.