Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0040929.1

Orthogroup ID

OG0031602

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 1183

Gene Structure 1183 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0040929.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 495 bp

ctcttcaacacatatcgaagcttcgcaagtgaccaagagagggagggcatctccaggagcctacagcagacagaggactggctttatgatgatggagatgatgaaactgaaaatgcctatacttcaaagctggaagatcttaagaagctggtagatccaattgaaagccgatataaagatgaggaagcaagagcacaggctactagagatctattaaagtgcattggtgattatcgcatggctgcggattcactttcacccatggataaagaatcgattgttaccgagtgctttaaggtggagcagtggcttagagagaaaaaccaacagcaaaactccatgccaaagaacatggacccaatattatggtcgagtgatattaagagccggactgaggagttgaactcgaaattcaaacacatatttagatccagggcttctcatcgagatgaccacaagggttcaaaccagcatgatacttctagacacaaatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04530 ko04612 map04530 map04612

Pfam Domains

Protein Families

HSP70

Protein Analysis

164

Amino Acids

19.34

Weight (kDa)

5.44

Isoelectric Point (pI)

57.57

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0031602)

Species	Orthologous Gene IDs
rosa_multiflora	Rmu_co8328269.1_g000001 Rmu_sc0040929.1_g000001

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	245
AclWI	GGATC	2 cut(s)	149, 423
AcsI	RAATTY	1 cut(s)	410
AfiI	CCNNNNNNNGG	2 cut(s)	40, 394
AflII	CTTAAG	1 cut(s)	140
AgsI	TTSAA	6 cut(s)	7, 126, 164, 403, 415, 465
AjnI	CCWGG	2 cut(s)	53, 431
AluBI	AGCT	3 cut(s)	21, 130, 148
AluI	AGCT	3 cut(s)	21, 130, 148
Alw21I	GWGCWC	1 cut(s)	196
AlwI	GGATC	2 cut(s)	149, 423
ApeKI	GCWGC	1 cut(s)	242
ApoI	RAATTY	1 cut(s)	410
AspS9I	GGNCC	1 cut(s)	355
AsuHPI	GGTGA	2 cut(s)	239, 249
AvaII	GGWCC	1 cut(s)	355
Bbv12I	GWGCWC	1 cut(s)	196
BbvI	GCAGC	1 cut(s)	229
BccI	CCATC	1 cut(s)	86
BciT130I	CCWGG	2 cut(s)	55, 433
BfaI	CTAG	2 cut(s)	204, 483
BfmI	CTRYAG	1 cut(s)	62
BfrI	CTTAAG	1 cut(s)	140
BglII	AGATCT	2 cut(s)	136, 208
BisI	GCNGC	1 cut(s)	243
BlsI	GCNGC	1 cut(s)	244
Bme1390I	CCNGG	2 cut(s)	55, 433
Bme18I	GGWCC	1 cut(s)	355
BmgT120I	GGNCC	1 cut(s)	355
BmiI	GGNNCC	2 cut(s)	59, 357
BmrFI	CCNGG	2 cut(s)	55, 433
BmsI	GCATC	1 cut(s)	57
BplI	GAGNNNNNCTC	4 cut(s)	35, 67, 389, 421
BpmI	CTGGAG	1 cut(s)	37
Bsa29I	ATCGAT	1 cut(s)	275
BsaJI	CCNNGG	2 cut(s)	261, 432
Bsc4I	CCNNNNNNNGG	2 cut(s)	40, 394
Bse1I	ACTGG	1 cut(s)	83
BseBI	CCWGG	2 cut(s)	55, 433
BseCI	ATCGAT	1 cut(s)	275
BseDI	CCNNGG	2 cut(s)	261, 432
BseLI	CCNNNNNNNGG	2 cut(s)	40, 394
BseMII	CTCAG	1 cut(s)	384
BseNI	ACTGG	1 cut(s)	83
BseRI	GAGGAG	1 cut(s)	410
BseXI	GCAGC	1 cut(s)	229
BshVI	ATCGAT	1 cut(s)	275
BsiHKAI	GWGCWC	1 cut(s)	196
BsiSI	CCGG	1 cut(s)	388
BslI	CCNNNNNNNGG	2 cut(s)	40, 394
Bsp1286I	GDGCHC	1 cut(s)	196
Bsp143I	GATC	4 cut(s)	136, 154, 208, 428
Bsp19I	CCATGG	1 cut(s)	261
BspACI	CCGC	1 cut(s)	245
BspCNI	CTCAG	1 cut(s)	385
BspDI	ATCGAT	1 cut(s)	275
BspLI	GGNNCC	2 cut(s)	59, 357
BspPI	GGATC	2 cut(s)	149, 423
BspTI	CTTAAG	1 cut(s)	140
BsrI	ACTGG	1 cut(s)	83
BssECI	CCNNGG	2 cut(s)	261, 432
BssMI	GATC	4 cut(s)	136, 154, 208, 428
BssT1I	CCWWGG	1 cut(s)	261
Bst2UI	CCWGG	2 cut(s)	55, 433
Bst6I	CTCTTC	1 cut(s)	8
BstAFI	CTTAAG	1 cut(s)	140
BstDEI	CTNAG	2 cut(s)	311, 393
BstDSI	CCRYGG	1 cut(s)	261
BstKTI	GATC	4 cut(s)	139, 157, 211, 431
BstMBI	GATC	4 cut(s)	136, 154, 208, 428
BstNI	CCWGG	2 cut(s)	55, 433
BstSCI	CCNGG	2 cut(s)	53, 431
BstSFI	CTRYAG	1 cut(s)	62
BstV1I	GCAGC	1 cut(s)	229
BstX2I	RGATCY	4 cut(s)	136, 154, 208, 428
BstXI	CCANNNNNNTGG	1 cut(s)	366
BstYI	RGATCY	4 cut(s)	136, 154, 208, 428
Bsu15I	ATCGAT	1 cut(s)	275
BsuTUI	ATCGAT	1 cut(s)	275
BtgI	CCRYGG	1 cut(s)	261
BtsI	GCAGTG	1 cut(s)	311
BtsIMutI	CAGTG	1 cut(s)	311
Cfr13I	GGNCC	1 cut(s)	355
ClaI	ATCGAT	1 cut(s)	275
CviAII	CATG	5 cut(s)	238, 262, 340, 352, 473
DdeI	CTNAG	2 cut(s)	311, 393
DpnI	GATC	4 cut(s)	138, 156, 210, 430
DpnII	GATC	4 cut(s)	136, 154, 208, 428
Eam1104I	CTCTTC	1 cut(s)	8
EarI	CTCTTC	1 cut(s)	8
Eco130I	CCWWGG	1 cut(s)	261
Eco47I	GGWCC	1 cut(s)	355
EcoRII	CCWGG	2 cut(s)	53, 431
EcoT14I	CCWWGG	1 cut(s)	261
ErhI	CCWWGG	1 cut(s)	261
FaeI	CATG	5 cut(s)	241, 265, 343, 355, 476
FatI	CATG	5 cut(s)	237, 261, 339, 351, 472
Fnu4HI	GCNGC	1 cut(s)	243
Fsp4HI	GCNGC	1 cut(s)	243
FspBI	CTAG	2 cut(s)	204, 483
GluI	GCNGC	1 cut(s)	243
GsuI	CTGGAG	1 cut(s)	37
HapII	CCGG	1 cut(s)	388
Hin1II	CATG	5 cut(s)	241, 265, 343, 355, 476
HindIII	AAGCTT	1 cut(s)	19
HinfI	GANTC	2 cut(s)	248, 272
HpaII	CCGG	1 cut(s)	388
HphI	GGTGA	2 cut(s)	239, 249
Hpy188III	TCNNGA	2 cut(s)	446, 483
HpyCH4V	TGCA	1 cut(s)	222
HpyF3I	CTNAG	2 cut(s)	311, 393
Hsp92II	CATG	5 cut(s)	241, 265, 343, 355, 476
Kzo9I	GATC	4 cut(s)	136, 154, 208, 428
LmnI	GCTCC	2 cut(s)	57, 301
Lsp1109I	GCAGC	1 cut(s)	229
LweI	GCATC	1 cut(s)	57
MaeI	CTAG	2 cut(s)	204, 483
MaeIII	GTNAC	2 cut(s)	29, 280
MalI	GATC	4 cut(s)	138, 156, 210, 430
MboI	GATC	4 cut(s)	136, 154, 208, 428
MboII	GAAGA	1 cut(s)	146
MfeI	CAATTG	1 cut(s)	159
MflI	RGATCY	4 cut(s)	136, 154, 208, 428
MhlI	GDGCHC	1 cut(s)	196
MluCI	AATT	2 cut(s)	159, 410
MnlI	CCTC	5 cut(s)	33, 37, 67, 175, 388
MseI	TTAA	4 cut(s)	141, 215, 294, 381
MslI	CAYNNNNRTG	1 cut(s)	447
MspCI	CTTAAG	1 cut(s)	140
MspI	CCGG	1 cut(s)	388
MspR9I	CCNGG	2 cut(s)	55, 433
MunI	CAATTG	1 cut(s)	159
MvaI	CCWGG	2 cut(s)	55, 433
NcoI	CCATGG	1 cut(s)	261
NdeII	GATC	4 cut(s)	136, 154, 208, 428
NlaIII	CATG	5 cut(s)	241, 265, 343, 355, 476
NlaIV	GGNNCC	2 cut(s)	59, 357
NmuCI	GTSAC	1 cut(s)	29
PfeI	GAWTC	2 cut(s)	248, 272
PfoI	TCCNGGA	1 cut(s)	53
PkrI	GCNGC	1 cut(s)	244
Psp6I	CCWGG	2 cut(s)	53, 431
PspGI	CCWGG	2 cut(s)	53, 431
PspN4I	GGNNCC	2 cut(s)	59, 357
PspPI	GGNCC	1 cut(s)	355
PsuI	RGATCY	4 cut(s)	136, 154, 208, 428
RseI	CAYNNNNRTG	1 cut(s)	447
SaqAI	TTAA	4 cut(s)	141, 215, 294, 381
SatI	GCNGC	1 cut(s)	243
Sau3AI	GATC	4 cut(s)	136, 154, 208, 428
Sau96I	GGNCC	1 cut(s)	355
ScrFI	CCNGG	2 cut(s)	55, 433
SduI	GDGCHC	1 cut(s)	196
SetI	ASST	4 cut(s)	23, 132, 150, 300
SfaNI	GCATC	1 cut(s)	57
SfcI	CTRYAG	1 cut(s)	62
SinI	GGWCC	1 cut(s)	355
SmiMI	CAYNNNNRTG	1 cut(s)	447
SmlI	CTYRAG	1 cut(s)	140
SmoI	CTYRAG	1 cut(s)	140
Sse9I	AATT	2 cut(s)	159, 410
SsiI	CCGC	1 cut(s)	245
SspI	AATATT	1 cut(s)	363
SspMI	CTAG	2 cut(s)	204, 483
StyD4I	CCNGG	2 cut(s)	53, 431
StyI	CCWWGG	1 cut(s)	261
TaqI	TCGA	5 cut(s)	16, 275, 371, 407, 445
TasI	AATT	2 cut(s)	159, 410
TfiI	GAWTC	2 cut(s)	248, 272
Tru1I	TTAA	4 cut(s)	141, 215, 294, 381
Tru9I	TTAA	4 cut(s)	141, 215, 294, 381
TscAI	CASTG	1 cut(s)	311
TseFI	GTSAC	1 cut(s)	29
TseI	GCWGC	1 cut(s)	242
Tsp45I	GTSAC	1 cut(s)	29
TspDTI	ATGAA	1 cut(s)	117
TspRI	CASTG	1 cut(s)	311
Vha464I	CTTAAG	1 cut(s)	140
VpaK11BI	GGWCC	1 cut(s)	355
XapI	RAATTY	1 cut(s)	410
XbaI	TCTAGA	1 cut(s)	482
XspI	CTAG	2 cut(s)	204, 483

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.