Rmu_co8332515.1_g000001

LRR receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8332515.1
Physical Location & Seq
Forward (+)
103 .. 938
836 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8332515.1_g000001.1.cds

Sequence Viewer

Length: 561 bp
atgatttctgccttgcaacatccaaaccttgtgaagctgtatggatgttgtgttgaaggaaaccagatgttgttaatttacgagtacatggagaataactgtgtatcacgtgctcttttcgcgagagaccctacttgcagattgaaattggactggcctactaggaagaacatttgcctaggtattgctagaggtttggcctatctacatgaagaatccagaataagaatagtgcatcgcgatatcaagacgagcaatgtgttgcttgataagaatttcaatgctaaaatctctgattttggcttggcaaagcttaatgaggatggcaacacccacattagcactcggattgctggaaccattggttatatggctcctgagtatgccatgcgtggctacttaactgcaaaagcagatgtttatagctttggagttgtggcactagaaattgttagcggaaagagcaatacaaactataggccaaaggaggaattcgtctaccttcttgattgggtaattacacactttgaattttgtttcattttcttccctcggttttaa

Protein Analysis

186

Amino Acids

21.38

Weight (kDa)

8.5

Isoelectric Point (pI)

19.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0031331)

Species Orthologous Gene IDs
rosa_multiflora Rmu_co8332515.1_g000001 Rmu_sc0004990.1_g000023

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 498
AccII CGCG 2 cut(s) 122, 240
AciI CCGC 1 cut(s) 456
AcsI RAATTY 3 cut(s) 274, 491, 530
AcvI CACGTG 1 cut(s) 110
AfaI GTAC 1 cut(s) 86
AgsI TTSAA 4 cut(s) 56, 145, 280, 530
AluBI AGCT 3 cut(s) 37, 313, 426
AluI AGCT 3 cut(s) 37, 313, 426
Alw21I GWGCWC 1 cut(s) 115
Alw26I GTCTC 1 cut(s) 120
AoxI GGCC 3 cut(s) 155, 198, 479
ApoI RAATTY 3 cut(s) 274, 491, 530
AspA2I CCTAGG 1 cut(s) 178
AvrII CCTAGG 1 cut(s) 178
BbrPI CACGTG 1 cut(s) 110
Bbv12I GWGCWC 1 cut(s) 115
BccI CCATC 1 cut(s) 317
BcoDI GTCTC 1 cut(s) 120
BfaI CTAG 4 cut(s) 162, 179, 189, 443
BfmI CTRYAG 1 cut(s) 475
BlnI CCTAGG 1 cut(s) 178
BmiI GGNNCC 2 cut(s) 358, 375
BmsI GCATC 1 cut(s) 244
BsaAI YACGTR 1 cut(s) 110
BsaI GGTCTC 1 cut(s) 120
BsaJI CCNNGG 2 cut(s) 178, 551
Bse1I ACTGG 1 cut(s) 158
Bse3DI GCAATG 1 cut(s) 262
BseDI CCNNGG 2 cut(s) 178, 551
BseGI GGATG 3 cut(s) 19, 50, 328
BseMI GCAATG 1 cut(s) 262
BseMII CTCAG 1 cut(s) 369
BseNI ACTGG 1 cut(s) 158
Bsh1236I CGCG 2 cut(s) 122, 240
BshFI GGCC 3 cut(s) 157, 200, 481
BsiHKAI GWGCWC 1 cut(s) 115
BsmAI GTCTC 1 cut(s) 120
BsnI GGCC 3 cut(s) 157, 200, 481
Bso31I GGTCTC 1 cut(s) 120
Bsp1286I GDGCHC 1 cut(s) 115
Bsp68I TCGCGA 2 cut(s) 122, 240
BspACI CCGC 1 cut(s) 456
BspANI GGCC 3 cut(s) 157, 200, 481
BspCNI CTCAG 1 cut(s) 370
BspFNI CGCG 2 cut(s) 122, 240
BspLI GGNNCC 2 cut(s) 358, 375
BspTNI GGTCTC 1 cut(s) 120
BsrDI GCAATG 1 cut(s) 262
BsrI ACTGG 1 cut(s) 158
BssECI CCNNGG 2 cut(s) 178, 551
BssT1I CCWWGG 1 cut(s) 178
Bst4CI ACNGT 1 cut(s) 101
BstBAI YACGTR 1 cut(s) 110
BstDEI CTNAG 1 cut(s) 378
BstF5I GGATG 3 cut(s) 19, 50, 328
BstFNI CGCG 2 cut(s) 122, 240
BstMAI GTCTC 1 cut(s) 120
BstMWI GCNNNNNNNGC 2 cut(s) 119, 462
BstSFI CTRYAG 1 cut(s) 475
BstUI CGCG 2 cut(s) 122, 240
BsuRI GGCC 3 cut(s) 157, 200, 481
BtgZI GCGATG 1 cut(s) 221
BtsCI GGATG 3 cut(s) 19, 50, 328
BtuMI TCGCGA 2 cut(s) 122, 240
Csp6I GTAC 1 cut(s) 85
CviAII CATG 3 cut(s) 88, 209, 388
CviJI RGCY 9 cut(s) 37, 157, 200, 303, 313, 374, 396, 426, 481
CviKI_1 RGCY 9 cut(s) 37, 157, 200, 303, 313, 374, 396, 426, 481
CviQI GTAC 1 cut(s) 85
DdeI CTNAG 1 cut(s) 378
Eco130I CCWWGG 1 cut(s) 178
Eco31I GGTCTC 1 cut(s) 120
Eco32I GATATC 1 cut(s) 244
Eco72I CACGTG 1 cut(s) 110
EcoRI GAATTC 1 cut(s) 491
EcoRV GATATC 1 cut(s) 244
EcoT14I CCWWGG 1 cut(s) 178
ErhI CCWWGG 1 cut(s) 178
FaeI CATG 3 cut(s) 91, 212, 391
FaiI YATR 9 cut(s) 42, 89, 210, 369, 371, 384, 389, 423, 477
FatI CATG 3 cut(s) 87, 208, 387
FblI GTMKAC 1 cut(s) 498
FokI GGATG 3 cut(s) 6, 57, 335
FspBI CTAG 4 cut(s) 162, 179, 189, 443
HaeIII GGCC 3 cut(s) 157, 200, 481
Hin1II CATG 3 cut(s) 91, 212, 391
HindIII AAGCTT 1 cut(s) 311
HinfI GANTC 1 cut(s) 215
Hpy166II GTNNAC 1 cut(s) 499
Hpy188I TCNGA 2 cut(s) 295, 348
Hpy188III TCNNGA 6 cut(s) 121, 219, 239, 247, 377, 506
Hpy8I GTNNAC 1 cut(s) 499
HpyAV CCTTC 2 cut(s) 50, 512
HpyCH4III ACNGT 1 cut(s) 101
HpyCH4IV ACGT 1 cut(s) 109
HpyCH4V TGCA 4 cut(s) 16, 138, 235, 407
HpyF10VI GCNNNNNNNGC 2 cut(s) 119, 462
HpyF3I CTNAG 1 cut(s) 378
HpySE526I ACGT 1 cut(s) 109
Hsp92II CATG 3 cut(s) 91, 212, 391
LmnI GCTCC 1 cut(s) 379
LpnPI CCDG 5 cut(s) 77, 139, 232, 339, 390
LweI GCATC 1 cut(s) 244
MaeI CTAG 4 cut(s) 162, 179, 189, 443
MaeII ACGT 1 cut(s) 109
MboII GAAGA 3 cut(s) 178, 224, 538
MhlI GDGCHC 1 cut(s) 115
MluCI AATT 7 cut(s) 75, 146, 274, 447, 491, 516, 530
MnlI CCTC 4 cut(s) 185, 313, 481, 561
MseI TTAA 4 cut(s) 74, 315, 401, 559
MvnI CGCG 2 cut(s) 122, 240
MwoI GCNNNNNNNGC 2 cut(s) 119, 462
NlaIII CATG 3 cut(s) 91, 212, 391
NlaIV GGNNCC 2 cut(s) 358, 375
NruI TCGCGA 2 cut(s) 122, 240
PfeI GAWTC 1 cut(s) 215
PmaCI CACGTG 1 cut(s) 110
PmlI CACGTG 1 cut(s) 110
Ppu21I YACGTR 1 cut(s) 110
PspCI CACGTG 1 cut(s) 110
PspN4I GGNNCC 2 cut(s) 358, 375
RruI TCGCGA 2 cut(s) 122, 240
RsaI GTAC 1 cut(s) 86
RsaNI GTAC 1 cut(s) 85
SaqAI TTAA 4 cut(s) 74, 315, 401, 559
SduI GDGCHC 1 cut(s) 115
SetI ASST 8 cut(s) 30, 39, 112, 184, 196, 315, 428, 504
SfaNI GCATC 1 cut(s) 244
SfcI CTRYAG 1 cut(s) 475
Sse9I AATT 7 cut(s) 75, 146, 274, 447, 491, 516, 530
SsiI CCGC 1 cut(s) 456
SspMI CTAG 4 cut(s) 162, 179, 189, 443
StyI CCWWGG 1 cut(s) 178
TaaI ACNGT 1 cut(s) 101
TaiI ACGT 1 cut(s) 112
TasI AATT 7 cut(s) 75, 146, 274, 447, 491, 516, 530
TatI WGTACW 1 cut(s) 84
TfiI GAWTC 1 cut(s) 215
Tru1I TTAA 4 cut(s) 74, 315, 401, 559
Tru9I TTAA 4 cut(s) 74, 315, 401, 559
TspDTI ATGAA 2 cut(s) 225, 529
XapI RAATTY 3 cut(s) 274, 491, 530
XcmI CCANNNNNNNNNTGG 1 cut(s) 367
XmaJI CCTAGG 1 cut(s) 178
XmiI GTMKAC 1 cut(s) 498
XspI CTAG 4 cut(s) 162, 179, 189, 443
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.