Rmu_sc0004990.1_g000023
ERF Family

Belongs to the protein kinase superfamily

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004990.1
Physical Location & Seq
Forward (+)
84407 .. 89842
5436 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004990.1_g000023.1.cds

Sequence Viewer

Length: 678 bp
atggttgaagaaacgggtgatgctgaagatccacgcgtcaaggtgcctgtaggagtagcatcccaccaaggaaagaaccagtttgtaactgagattgccactatatctgctgtgcaacacaataacctggtaaagttgtacggattctgcactgagggagttaaaaggctccttgtctatgagtatctggagaacaacagtcttgatcaagcattatttggagagagacgtttaaatcttgattggtcaacacgttttaatatatgcttgggcatagctagaggtttaacttatcttcacgaagaatcaagggttcgaattgtacacagagatgtgaaggccagtaatattctgcttgacactgatctcatccccaagatatcggattttggtttggctaagctttttgatgagaaaaagacccacataagtacccgtgttgcgggaacatttgggtatcttgcaccggaatatgccatgcgtggacaccttacagagaagactgatgtctttgcctttggtgttgtggctcttgaaattgtcagtggtaggccaaattctgatccgagtttgggtgaagaaatgacttatcttctcgaatgggtaagaactttgtttttggtcctccctgtctatccttccttgccacaaatgttccgagtttttttcagtgtttga

Protein Analysis

225

Amino Acids

25.43

Weight (kDa)

5.89

Isoelectric Point (pI)

35.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0031331)

Species Orthologous Gene IDs
rosa_multiflora Rmu_co8332515.1_g000001 Rmu_sc0004990.1_g000023

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 43
AccII CGCG 1 cut(s) 36
AciI CCGC 1 cut(s) 443
AclWI GGATC 2 cut(s) 23, 557
AcsI RAATTY 1 cut(s) 556
AcuI CTGAAG 1 cut(s) 45
AfaI GTAC 3 cut(s) 140, 324, 433
AfiI CCNNNNNNNGG 2 cut(s) 442, 572
AflIII ACRYGT 2 cut(s) 34, 251
AgsI TTSAA 2 cut(s) 8, 536
AjnI CCWGG 1 cut(s) 126
AluBI AGCT 2 cut(s) 278, 403
AluI AGCT 2 cut(s) 278, 403
Alw26I GTCTC 1 cut(s) 220
AlwI GGATC 2 cut(s) 23, 557
AoxI GGCC 2 cut(s) 339, 551
ApoI RAATTY 1 cut(s) 556
AspS9I GGNCC 1 cut(s) 622
AsuHPI GGTGA 2 cut(s) 29, 587
AsuII TTCGAA 1 cut(s) 316
AvaII GGWCC 1 cut(s) 622
BaeI ACNNNNGTAYC 2 cut(s) 415, 448
BanI GGYRCC 1 cut(s) 43
BbsI GAAGAC 1 cut(s) 506
BciT130I CCWGG 1 cut(s) 128
BclI TGATCA 1 cut(s) 205
BcoDI GTCTC 1 cut(s) 220
BfaI CTAG 1 cut(s) 279
BfmI CTRYAG 1 cut(s) 48
BlpI GCTNAGC 1 cut(s) 399
Bme1390I CCNGG 1 cut(s) 128
Bme18I GGWCC 1 cut(s) 622
BmgT120I GGNCC 1 cut(s) 622
BmiI GGNNCC 2 cut(s) 45, 170
BmrFI CCNGG 1 cut(s) 128
BmsI GCATC 2 cut(s) 10, 68
BoxI GACNNNNGTC 1 cut(s) 506
BpiI GAAGAC 1 cut(s) 506
BpmI CTGGAG 1 cut(s) 209
Bpu1102I GCTNAGC 1 cut(s) 399
Bpu14I TTCGAA 1 cut(s) 316
BsaJI CCNNGG 1 cut(s) 67
BsaWI WCCGGW 1 cut(s) 466
Bsc4I CCNNNNNNNGG 2 cut(s) 442, 572
Bse1I ACTGG 2 cut(s) 79, 342
BseBI CCWGG 1 cut(s) 128
BseDI CCNNGG 1 cut(s) 67
BseGI GGATG 2 cut(s) 59, 369
BseLI CCNNNNNNNGG 2 cut(s) 442, 572
BseMII CTCAG 2 cut(s) 81, 144
BseNI ACTGG 2 cut(s) 79, 342
BsgI GTGCAG 1 cut(s) 133
Bsh1236I CGCG 1 cut(s) 36
BshFI GGCC 2 cut(s) 341, 553
BshNI GGYRCC 1 cut(s) 43
BsiSI CCGG 1 cut(s) 467
BslI CCNNNNNNNGG 2 cut(s) 442, 572
BsmAI GTCTC 1 cut(s) 220
BsmBI CGTCTC 1 cut(s) 220
BsnI GGCC 2 cut(s) 341, 553
Bsp119I TTCGAA 1 cut(s) 316
Bsp1407I TGTACA 1 cut(s) 322
Bsp143I GATC 4 cut(s) 28, 205, 364, 562
Bsp1720I GCTNAGC 1 cut(s) 399
BspACI CCGC 1 cut(s) 443
BspANI GGCC 2 cut(s) 341, 553
BspCNI CTCAG 2 cut(s) 82, 145
BspFNI CGCG 1 cut(s) 36
BspLI GGNNCC 2 cut(s) 45, 170
BspPI GGATC 2 cut(s) 23, 557
BspT104I TTCGAA 1 cut(s) 316
BspT107I GGYRCC 1 cut(s) 43
BsrGI TGTACA 1 cut(s) 322
BsrI ACTGG 2 cut(s) 79, 342
BssECI CCNNGG 1 cut(s) 67
BssMI GATC 4 cut(s) 28, 205, 364, 562
BssT1I CCWWGG 1 cut(s) 67
Bst2UI CCWGG 1 cut(s) 128
Bst4CI ACNGT 1 cut(s) 200
BstAUI TGTACA 1 cut(s) 322
BstBI TTCGAA 1 cut(s) 316
BstDEI CTNAG 3 cut(s) 90, 153, 399
BstF5I GGATG 2 cut(s) 59, 369
BstFNI CGCG 1 cut(s) 36
BstKTI GATC 4 cut(s) 31, 208, 367, 565
BstMAI GTCTC 1 cut(s) 220
BstMBI GATC 4 cut(s) 28, 205, 364, 562
BstNI CCWGG 1 cut(s) 128
BstPAI GACNNNNGTC 1 cut(s) 506
BstSCI CCNGG 1 cut(s) 126
BstSFI CTRYAG 1 cut(s) 48
BstUI CGCG 1 cut(s) 36
BstV2I GAAGAC 1 cut(s) 506
BstX2I RGATCY 1 cut(s) 28
BstYI RGATCY 1 cut(s) 28
BsuRI GGCC 2 cut(s) 341, 553
BtsCI GGATG 2 cut(s) 59, 369
BtsIMutI CAGTG 4 cut(s) 150, 360, 550, 676
Cfr13I GGNCC 1 cut(s) 622
CseI GACGC 1 cut(s) 25
CsiI ACCWGGT 1 cut(s) 126
Csp6I GTAC 3 cut(s) 139, 323, 432
CviAII CATG 1 cut(s) 478
CviJI RGCY 7 cut(s) 169, 278, 341, 398, 403, 530, 553
CviKI_1 RGCY 7 cut(s) 169, 278, 341, 398, 403, 530, 553
CviQI GTAC 3 cut(s) 139, 323, 432
DdeI CTNAG 3 cut(s) 90, 153, 399
DpnI GATC 4 cut(s) 30, 207, 366, 564
DpnII GATC 4 cut(s) 28, 205, 364, 562
DraI TTTAAA 1 cut(s) 234
Eco130I CCWWGG 1 cut(s) 67
Eco32I GATATC 1 cut(s) 381
Eco47I GGWCC 1 cut(s) 622
Eco57I CTGAAG 1 cut(s) 45
EcoRII CCWGG 1 cut(s) 126
EcoRV GATATC 1 cut(s) 381
EcoT14I CCWWGG 1 cut(s) 67
ErhI CCWWGG 1 cut(s) 67
Esp3I CGTCTC 1 cut(s) 220
FaeI CATG 1 cut(s) 481
FaiI YATR 8 cut(s) 104, 180, 263, 265, 275, 428, 474, 479
FatI CATG 1 cut(s) 477
FauI CCCGC 1 cut(s) 436
FbaI TGATCA 1 cut(s) 205
FokI GGATG 2 cut(s) 46, 356
FspBI CTAG 1 cut(s) 279
GsuI CTGGAG 1 cut(s) 209
HaeIII GGCC 2 cut(s) 341, 553
HapII CCGG 1 cut(s) 467
HgaI GACGC 1 cut(s) 25
Hin1II CATG 1 cut(s) 481
HincII GTYRAC 1 cut(s) 249
HindII GTYRAC 1 cut(s) 249
HindIII AAGCTT 1 cut(s) 401
HinfI GANTC 2 cut(s) 144, 305
HpaII CCGG 1 cut(s) 467
HphI GGTGA 2 cut(s) 29, 587
Hpy166II GTNNAC 3 cut(s) 249, 325, 485
Hpy188I TCNGA 4 cut(s) 385, 562, 567, 659
Hpy188III TCNNGA 6 cut(s) 188, 203, 239, 299, 533, 596
Hpy8I GTNNAC 3 cut(s) 249, 325, 485
HpyAV CCTTC 2 cut(s) 331, 648
HpyCH4III ACNGT 1 cut(s) 200
HpyCH4IV ACGT 2 cut(s) 229, 253
HpyCH4V TGCA 3 cut(s) 115, 150, 464
HpyF3I CTNAG 3 cut(s) 90, 153, 399
HpySE526I ACGT 2 cut(s) 229, 253
Hsp92II CATG 1 cut(s) 481
Ksp22I TGATCA 1 cut(s) 205
Kzo9I GATC 4 cut(s) 28, 205, 364, 562
LmnI GCTCC 1 cut(s) 174
LpnPI CCDG 8 cut(s) 60, 92, 113, 140, 173, 355, 480, 642
LweI GCATC 2 cut(s) 10, 68
MabI ACCWGGT 1 cut(s) 126
MaeI CTAG 1 cut(s) 279
MaeII ACGT 2 cut(s) 229, 253
MaeIII GTNAC 1 cut(s) 85
MalI GATC 4 cut(s) 30, 207, 366, 564
MboI GATC 4 cut(s) 28, 205, 364, 562
MboII GAAGA 7 cut(s) 20, 38, 287, 314, 511, 584, 590
MflI RGATCY 1 cut(s) 28
MluCI AATT 3 cut(s) 318, 537, 556
MluI ACGCGT 1 cut(s) 34
MnlI CCTC 3 cut(s) 148, 275, 635
MseI TTAA 4 cut(s) 162, 233, 258, 287
MslI CAYNNNNRTG 1 cut(s) 330
MspI CCGG 1 cut(s) 467
MspR9I CCNGG 1 cut(s) 128
MvaI CCWGG 1 cut(s) 128
MvnI CGCG 1 cut(s) 36
NdeII GATC 4 cut(s) 28, 205, 364, 562
NlaIII CATG 1 cut(s) 481
NlaIV GGNNCC 2 cut(s) 45, 170
NspV TTCGAA 1 cut(s) 316
PfeI GAWTC 2 cut(s) 144, 305
PshAI GACNNNNGTC 1 cut(s) 506
Psp6I CCWGG 1 cut(s) 126
PspGI CCWGG 1 cut(s) 126
PspN4I GGNNCC 2 cut(s) 45, 170
PspPI GGNCC 1 cut(s) 622
PsuI RGATCY 1 cut(s) 28
RsaI GTAC 3 cut(s) 140, 324, 433
RsaNI GTAC 3 cut(s) 139, 323, 432
RseI CAYNNNNRTG 1 cut(s) 330
SaqAI TTAA 4 cut(s) 162, 233, 258, 287
Sau3AI GATC 4 cut(s) 28, 205, 364, 562
Sau96I GGNCC 1 cut(s) 622
ScrFI CCNGG 1 cut(s) 128
SetI ASST 8 cut(s) 45, 129, 232, 256, 280, 286, 405, 492
SexAI ACCWGGT 1 cut(s) 126
SfaNI GCATC 2 cut(s) 10, 68
SfcI CTRYAG 1 cut(s) 48
SfuI TTCGAA 1 cut(s) 316
SinI GGWCC 1 cut(s) 622
SmiMI CAYNNNNRTG 1 cut(s) 330
Sse9I AATT 3 cut(s) 318, 537, 556
SsiI CCGC 1 cut(s) 443
SspI AATATT 1 cut(s) 349
SspMI CTAG 1 cut(s) 279
StyD4I CCNGG 1 cut(s) 126
StyI CCWWGG 1 cut(s) 67
TaaI ACNGT 1 cut(s) 200
TaiI ACGT 2 cut(s) 232, 256
TaqI TCGA 2 cut(s) 316, 597
TasI AATT 3 cut(s) 318, 537, 556
TatI WGTACW 1 cut(s) 322
TfiI GAWTC 2 cut(s) 144, 305
Tru1I TTAA 4 cut(s) 162, 233, 258, 287
Tru9I TTAA 4 cut(s) 162, 233, 258, 287
TscAI CASTG 4 cut(s) 157, 367, 550, 676
TspGWI ACGGA 1 cut(s) 156
TspRI CASTG 4 cut(s) 157, 367, 550, 676
VpaK11BI GGWCC 1 cut(s) 622
XapI RAATTY 1 cut(s) 556
XspI CTAG 1 cut(s) 279
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.