Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8355393.1

Orthogroup ID

OG0029464

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 1044

Gene Structure 1044 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8355393.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 405 bp

atgaatttatgttttcaggcttgtagattgaaattaggagacctagaaggagcattgttggatacagactttgcattgcgtgattgggaggacaatgtgaaggctttgtttcgccaaggccagacatatatggcactaaatgacattgactctgcggttgaaagcttcaagaaggcactggaattggaaccaaatgatgggggaattaagaaagagcttctggttgctaaaaagaagctgataggagtgagagagaaaagagagcatattctcgaatgtttaaccaatgatggcagtcataagaggctgcacatgtatggatggactttgattccttttgcacttgctaaattacatagtcaactggttccttctgcagtcttaatcggcactatgaaataccag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04217 ko04218 map04217 map04218

Pfam Domains

Protein Families

Pro_isomerase TPR_1 TPR_2

Protein Analysis

135

Amino Acids

15.3

Weight (kDa)

7.72

Isoelectric Point (pI)

39.49

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0029464)

Species	Orthologous Gene IDs
pyrus_communis	pycom15g24280
rosa_multiflora	Rmu_co8355393.1_g000001

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	197
AciI	CCGC	1 cut(s)	155
AcsI	RAATTY	1 cut(s)	4
AfiI	CCNNNNNNNGG	1 cut(s)	197
AflIII	ACRYGT	1 cut(s)	312
AgsI	TTSAA	3 cut(s)	31, 161, 169
AluBI	AGCT	3 cut(s)	165, 217, 238
AluI	AGCT	3 cut(s)	165, 217, 238
Alw26I	GTCTC	1 cut(s)	33
AoxI	GGCC	1 cut(s)	118
ApeKI	GCWGC	1 cut(s)	307
ApoI	RAATTY	1 cut(s)	4
BbvI	GCAGC	1 cut(s)	294
BccI	CCATC	3 cut(s)	191, 284, 315
BciVI	GTATCC	1 cut(s)	55
BcoDI	GTCTC	1 cut(s)	33
BfaI	CTAG	1 cut(s)	44
BfmI	CTRYAG	1 cut(s)	375
BfuI	GTATCC	1 cut(s)	55
BisI	GCNGC	1 cut(s)	308
BlsI	GCNGC	1 cut(s)	309
BmiI	GGNNCC	2 cut(s)	189, 369
BsaI	GGTCTC	1 cut(s)	33
BsaJI	CCNNGG	1 cut(s)	115
Bsc4I	CCNNNNNNNGG	1 cut(s)	197
Bse1I	ACTGG	2 cut(s)	183, 369
Bse3DI	GCAATG	1 cut(s)	74
BseDI	CCNNGG	1 cut(s)	115
BseGI	GGATG	1 cut(s)	326
BseLI	CCNNNNNNNGG	1 cut(s)	197
BseMI	GCAATG	1 cut(s)	74
BseNI	ACTGG	2 cut(s)	183, 369
BseXI	GCAGC	1 cut(s)	294
BsgI	GTGCAG	1 cut(s)	293
BshFI	GGCC	1 cut(s)	120
BslI	CCNNNNNNNGG	1 cut(s)	197
BsmAI	GTCTC	1 cut(s)	33
BsnI	GGCC	1 cut(s)	120
Bso31I	GGTCTC	1 cut(s)	33
BspACI	CCGC	1 cut(s)	155
BspANI	GGCC	1 cut(s)	120
BspLI	GGNNCC	2 cut(s)	189, 369
BspMAI	CTGCAG	1 cut(s)	379
BspTNI	GGTCTC	1 cut(s)	33
BsrDI	GCAATG	1 cut(s)	74
BsrI	ACTGG	2 cut(s)	183, 369
BssECI	CCNNGG	1 cut(s)	115
BssT1I	CCWWGG	1 cut(s)	115
BstF5I	GGATG	1 cut(s)	326
BstMAI	GTCTC	1 cut(s)	33
BstNSI	RCATGY	1 cut(s)	316
BstSFI	CTRYAG	1 cut(s)	375
BstV1I	GCAGC	1 cut(s)	294
BsuI	GTATCC	1 cut(s)	55
BsuRI	GGCC	1 cut(s)	120
BtsCI	GGATG	1 cut(s)	326
BtsIMutI	CAGTG	1 cut(s)	176
CviAII	CATG	1 cut(s)	313
CviJI	RGCY	7 cut(s)	20, 104, 120, 165, 217, 238, 307
CviKI_1	RGCY	7 cut(s)	20, 104, 120, 165, 217, 238, 307
Eco130I	CCWWGG	1 cut(s)	115
Eco31I	GGTCTC	1 cut(s)	33
EcoT14I	CCWWGG	1 cut(s)	115
ErhI	CCWWGG	1 cut(s)	115
FaeI	CATG	1 cut(s)	316
FatI	CATG	1 cut(s)	312
Fnu4HI	GCNGC	1 cut(s)	308
FokI	GGATG	1 cut(s)	333
Fsp4HI	GCNGC	1 cut(s)	308
FspBI	CTAG	1 cut(s)	44
GluI	GCNGC	1 cut(s)	308
HaeIII	GGCC	1 cut(s)	120
Hin1II	CATG	1 cut(s)	316
HincII	GTYRAC	1 cut(s)	362
HindII	GTYRAC	1 cut(s)	362
HindIII	AAGCTT	1 cut(s)	163
HinfI	GANTC	2 cut(s)	149, 331
Hpy166II	GTNNAC	1 cut(s)	362
Hpy188III	TCNNGA	2 cut(s)	169, 272
Hpy8I	GTNNAC	1 cut(s)	362
HpyAV	CCTTC	4 cut(s)	41, 94, 166, 381
HpyCH4V	TGCA	4 cut(s)	74, 310, 341, 377
Hsp92II	CATG	1 cut(s)	316
LmnI	GCTCC	1 cut(s)	50
LpnPI	CCDG	5 cut(s)	2, 134, 164, 206, 350
Lsp1109I	GCAGC	1 cut(s)	294
MaeI	CTAG	1 cut(s)	44
MluCI	AATT	5 cut(s)	4, 32, 182, 204, 350
MlyI	GAGTC	1 cut(s)	143
MmeI	TCCRAC	1 cut(s)	39
MnlI	CCTC	2 cut(s)	82, 297
MseI	TTAA	3 cut(s)	207, 281, 383
MslI	CAYNNNNRTG	1 cut(s)	315
NlaIII	CATG	1 cut(s)	316
NlaIV	GGNNCC	2 cut(s)	189, 369
NspI	RCATGY	1 cut(s)	316
PciI	ACATGT	1 cut(s)	312
PfeI	GAWTC	1 cut(s)	331
PflMI	CCANNNNNTGG	1 cut(s)	197
PkrI	GCNGC	1 cut(s)	309
PleI	GAGTC	1 cut(s)	143
PpsI	GAGTC	1 cut(s)	143
PscI	ACATGT	1 cut(s)	312
PspN4I	GGNNCC	2 cut(s)	189, 369
PstI	CTGCAG	1 cut(s)	379
RseI	CAYNNNNRTG	1 cut(s)	315
SaqAI	TTAA	3 cut(s)	207, 281, 383
SatI	GCNGC	1 cut(s)	308
SchI	GAGTC	1 cut(s)	143
SetI	ASST	4 cut(s)	45, 167, 219, 240
SfcI	CTRYAG	1 cut(s)	375
SmiMI	CAYNNNNRTG	1 cut(s)	315
Sse9I	AATT	5 cut(s)	4, 32, 182, 204, 350
SsiI	CCGC	1 cut(s)	155
SspMI	CTAG	1 cut(s)	44
StyI	CCWWGG	1 cut(s)	115
TaqI	TCGA	1 cut(s)	273
TasI	AATT	5 cut(s)	4, 32, 182, 204, 350
TfiI	GAWTC	1 cut(s)	331
Tru1I	TTAA	3 cut(s)	207, 281, 383
Tru9I	TTAA	3 cut(s)	207, 281, 383
TscAI	CASTG	1 cut(s)	183
TseI	GCWGC	1 cut(s)	307
TspDTI	ATGAA	1 cut(s)	17
TspRI	CASTG	1 cut(s)	183
Van91I	CCANNNNNTGG	1 cut(s)	197
XapI	RAATTY	1 cut(s)	4
XceI	RCATGY	1 cut(s)	316
XspI	CTAG	1 cut(s)	44

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.