Rmu_co8368419.1_g000002

gag-polypeptide of LTR copia-type

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8368419.1
OG0031216
Physical Location & Seq
Reverse (-)
414 .. 698
285 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8368419.1_g000002.1.cds

Sequence Viewer

Length: 285 bp
atgagtaacctgaataaattggactttgctccattgggaataactgactctggatatcacaggtgggttcgtgatgtccgccaacatctcaaggccgatggaattctggatacgattctcgagcctagtcaggacgtgctaactgttgagcaagctcaagttttggaagcgaatagatcagccttagaggcaaataaggcgaaagccataaggctatgggtctcactcgaagaaagatttggcaacgtccatgagtccctgcttcctgaccaagaagtgagatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Retrotran_gag_2

Protein Analysis

94

Amino Acids

10.68

Weight (kDa)

5.26

Isoelectric Point (pI)

52.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0031216)

Species Orthologous Gene IDs
rosa_multiflora Rmu_co8368419.1_g000002 Rmu_sc0002578.1_g000005

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 79
AcsI RAATTY 1 cut(s) 102
AjiI CACGTC 1 cut(s) 136
AjuI GAANNNNNNNTTGG 2 cut(s) 222, 254
AluBI AGCT 1 cut(s) 155
AluI AGCT 1 cut(s) 155
Alw26I GTCTC 1 cut(s) 226
Ama87I CYCGRG 1 cut(s) 119
AoxI GGCC 1 cut(s) 93
ApoI RAATTY 1 cut(s) 102
AvaI CYCGRG 1 cut(s) 119
BccI CCATC 1 cut(s) 92
BciVI GTATCC 1 cut(s) 103
BcoDI GTCTC 1 cut(s) 226
BfaI CTAG 1 cut(s) 126
BfuI GTATCC 1 cut(s) 103
BglI GCCNNNNNGGC 1 cut(s) 188
BmeT110I CYCGRG 1 cut(s) 119
BmgBI CACGTC 1 cut(s) 136
BpuEI CTTGAG 2 cut(s) 74, 141
BsaI GGTCTC 1 cut(s) 226
BshFI GGCC 1 cut(s) 95
BsiHKCI CYCGRG 1 cut(s) 119
BslFI GGGAC 1 cut(s) 241
BsmAI GTCTC 1 cut(s) 226
BsmFI GGGAC 1 cut(s) 241
BsnI GGCC 1 cut(s) 95
Bso31I GGTCTC 1 cut(s) 226
BsoBI CYCGRG 1 cut(s) 119
Bsp143I GATC 1 cut(s) 176
BspACI CCGC 1 cut(s) 79
BspANI GGCC 1 cut(s) 95
BspTNI GGTCTC 1 cut(s) 226
BssMI GATC 1 cut(s) 176
Bst4CI ACNGT 1 cut(s) 145
BstC8I GCNNGC 1 cut(s) 153
BstDEI CTNAG 1 cut(s) 184
BstKTI GATC 1 cut(s) 179
BstMAI GTCTC 1 cut(s) 226
BstMBI GATC 1 cut(s) 176
BstMWI GCNNNNNNNGC 2 cut(s) 188, 197
BsuI GTATCC 1 cut(s) 103
BsuRI GGCC 1 cut(s) 95
BtrI CACGTC 1 cut(s) 136
Cac8I GCNNGC 1 cut(s) 153
CviAII CATG 1 cut(s) 251
CviJI RGCY 6 cut(s) 95, 124, 155, 182, 206, 214
CviKI_1 RGCY 6 cut(s) 95, 124, 155, 182, 206, 214
DdeI CTNAG 1 cut(s) 184
DpnI GATC 1 cut(s) 178
DpnII GATC 1 cut(s) 176
EciI GGCGGA 1 cut(s) 68
Eco31I GGTCTC 1 cut(s) 226
Eco32I GATATC 1 cut(s) 56
Eco88I CYCGRG 1 cut(s) 119
EcoRI GAATTC 1 cut(s) 102
EcoRV GATATC 1 cut(s) 56
FaeI CATG 1 cut(s) 254
FaiI YATR 3 cut(s) 209, 217, 252
FaqI GGGAC 1 cut(s) 241
FatI CATG 1 cut(s) 250
FspBI CTAG 1 cut(s) 126
HaeIII GGCC 1 cut(s) 95
Hin1II CATG 1 cut(s) 254
HinfI GANTC 3 cut(s) 47, 115, 254
Hpy188III TCNNGA 6 cut(s) 51, 71, 107, 119, 131, 266
HpyCH4III ACNGT 1 cut(s) 145
HpyCH4IV ACGT 2 cut(s) 135, 246
HpyF10VI GCNNNNNNNGC 2 cut(s) 188, 197
HpyF3I CTNAG 1 cut(s) 184
HpySE526I ACGT 2 cut(s) 135, 246
Hsp92II CATG 1 cut(s) 254
Kzo9I GATC 1 cut(s) 176
LmnI GCTCC 1 cut(s) 34
LpnPI CCDG 7 cut(s) 23, 36, 46, 92, 116, 272, 279
MaeI CTAG 1 cut(s) 126
MaeII ACGT 2 cut(s) 135, 246
MaeIII GTNAC 1 cut(s) 5
MalI GATC 1 cut(s) 178
MboI GATC 1 cut(s) 176
MboII GAAGA 1 cut(s) 242
MluCI AATT 2 cut(s) 17, 102
MlyI GAGTC 2 cut(s) 41, 263
MnlI CCTC 1 cut(s) 181
MwoI GCNNNNNNNGC 2 cut(s) 188, 197
NdeII GATC 1 cut(s) 176
NlaIII CATG 1 cut(s) 254
PaeR7I CTCGAG 1 cut(s) 119
PfeI GAWTC 1 cut(s) 115
PleI GAGTC 2 cut(s) 41, 262
PpsI GAGTC 2 cut(s) 41, 262
Sau3AI GATC 1 cut(s) 176
SchI GAGTC 2 cut(s) 41, 263
SetI ASST 5 cut(s) 12, 65, 138, 157, 249
Sfr274I CTCGAG 1 cut(s) 119
SlaI CTCGAG 1 cut(s) 119
SmlI CTYRAG 3 cut(s) 89, 119, 156
SmoI CTYRAG 3 cut(s) 89, 119, 156
Sse9I AATT 2 cut(s) 17, 102
SsiI CCGC 1 cut(s) 79
SspMI CTAG 1 cut(s) 126
TaaI ACNGT 1 cut(s) 145
TaiI ACGT 2 cut(s) 138, 249
TaqI TCGA 2 cut(s) 120, 228
TasI AATT 2 cut(s) 17, 102
TfiI GAWTC 1 cut(s) 115
XapI RAATTY 1 cut(s) 102
XhoI CTCGAG 1 cut(s) 119
XspI CTAG 1 cut(s) 126
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.