Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8407345.1

Orthogroup ID

OG0024727

Physical Location & Seq

Genomic Coordinates Forward (+)

921 .. 1207

Gene Structure 287 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8407345.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 201 bp

atgtcgaccttggccgatccgaaagctcaccaccatgaatttgttatccaagcaacaccagtgaagaggctgtgcaaaatccacaacaccatcacagtgaatggacagtttcctggaccaaccttggaagtaaacaatggcgatactcttgtcgtcaaagtcactaacaaagctcgatataatgtcaccattcactggtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0008150 GO:0008152 GO:0010035 GO:0010038 GO:0016491 GO:0016722 GO:0042221 GO:0046688 GO:0050896 GO:0055114

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Cu-oxidase Cu-oxidase_2 Cu-oxidase_3

Protein Analysis

66

Amino Acids

7.4

Weight (kDa)

9.43

Isoelectric Point (pI)

16.49

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0024727)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr1g0341991
rosa_multiflora	Rmu_co8407345.1_g000001
rosa_samantha	Rh1CG158400

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	195
AccI	GTMKAC	1 cut(s)	5
AclWI	GGATC	1 cut(s)	11
AcoI	YGGCCR	1 cut(s)	12
AcsI	RAATTY	1 cut(s)	38
AfiI	CCNNNNNNNGG	1 cut(s)	195
AjnI	CCWGG	1 cut(s)	112
AluBI	AGCT	2 cut(s)	26, 173
AluI	AGCT	2 cut(s)	26, 173
AlwI	GGATC	1 cut(s)	11
AoxI	GGCC	1 cut(s)	12
ApoI	RAATTY	1 cut(s)	38
AspS9I	GGNCC	1 cut(s)	116
AsuHPI	GGTGA	2 cut(s)	20, 178
AvaII	GGWCC	1 cut(s)	116
BaeI	ACNNNNGTAYC	2 cut(s)	135, 168
BccI	CCATC	1 cut(s)	98
BciT130I	CCWGG	1 cut(s)	114
Bme1390I	CCNGG	1 cut(s)	114
Bme18I	GGWCC	1 cut(s)	116
BmgT120I	GGNCC	1 cut(s)	116
BmrFI	CCNGG	1 cut(s)	114
BsaJI	CCNNGG	2 cut(s)	9, 123
Bsc4I	CCNNNNNNNGG	1 cut(s)	195
Bse1I	ACTGG	2 cut(s)	59, 200
BseBI	CCWGG	1 cut(s)	114
BseDI	CCNNGG	2 cut(s)	9, 123
BseLI	CCNNNNNNNGG	1 cut(s)	195
BseNI	ACTGG	2 cut(s)	59, 200
BshFI	GGCC	1 cut(s)	14
BslI	CCNNNNNNNGG	1 cut(s)	195
BsnI	GGCC	1 cut(s)	14
Bsp143I	GATC	1 cut(s)	16
BspANI	GGCC	1 cut(s)	14
BspPI	GGATC	1 cut(s)	11
BsrI	ACTGG	2 cut(s)	59, 200
BssECI	CCNNGG	2 cut(s)	9, 123
BssMI	GATC	1 cut(s)	16
BssT1I	CCWWGG	2 cut(s)	9, 123
Bst2UI	CCWGG	1 cut(s)	114
Bst4CI	ACNGT	2 cut(s)	97, 108
Bst6I	CTCTTC	1 cut(s)	59
BstKTI	GATC	1 cut(s)	19
BstMBI	GATC	1 cut(s)	16
BstNI	CCWGG	1 cut(s)	114
BstSCI	CCNGG	1 cut(s)	112
BsuRI	GGCC	1 cut(s)	14
BtsIMutI	CAGTG	3 cut(s)	66, 102, 193
Cfr13I	GGNCC	1 cut(s)	116
CviAII	CATG	1 cut(s)	35
CviJI	RGCY	4 cut(s)	14, 26, 70, 173
CviKI_1	RGCY	4 cut(s)	14, 26, 70, 173
DpnI	GATC	1 cut(s)	18
DpnII	GATC	1 cut(s)	16
EaeI	YGGCCR	1 cut(s)	12
Eam1104I	CTCTTC	1 cut(s)	59
EarI	CTCTTC	1 cut(s)	59
Eco130I	CCWWGG	2 cut(s)	9, 123
Eco47I	GGWCC	1 cut(s)	116
EcoRII	CCWGG	1 cut(s)	112
EcoT14I	CCWWGG	2 cut(s)	9, 123
ErhI	CCWWGG	2 cut(s)	9, 123
FaeI	CATG	1 cut(s)	38
FaiI	YATR	2 cut(s)	36, 180
FatI	CATG	1 cut(s)	34
FblI	GTMKAC	1 cut(s)	5
HaeIII	GGCC	1 cut(s)	14
Hin1II	CATG	1 cut(s)	38
HincII	GTYRAC	1 cut(s)	6
HindII	GTYRAC	1 cut(s)	6
HphI	GGTGA	2 cut(s)	20, 178
Hpy166II	GTNNAC	2 cut(s)	6, 133
Hpy188I	TCNGA	1 cut(s)	21
Hpy8I	GTNNAC	2 cut(s)	6, 133
HpyCH4III	ACNGT	2 cut(s)	97, 108
HpyCH4V	TGCA	1 cut(s)	75
Hsp92II	CATG	1 cut(s)	38
Kzo9I	GATC	1 cut(s)	16
LpnPI	CCDG	4 cut(s)	72, 99, 126, 181
MaeIII	GTNAC	2 cut(s)	160, 184
MalI	GATC	1 cut(s)	18
MboI	GATC	1 cut(s)	16
MboII	GAAGA	1 cut(s)	76
MluCI	AATT	1 cut(s)	38
MnlI	CCTC	1 cut(s)	60
MslI	CAYNNNNRTG	2 cut(s)	33, 95
MspR9I	CCNGG	1 cut(s)	114
MvaI	CCWGG	1 cut(s)	114
NdeII	GATC	1 cut(s)	16
NlaIII	CATG	1 cut(s)	38
NmuCI	GTSAC	2 cut(s)	160, 184
PflMI	CCANNNNNTGG	1 cut(s)	195
PfoI	TCCNGGA	1 cut(s)	112
Psp6I	CCWGG	1 cut(s)	112
PspGI	CCWGG	1 cut(s)	112
PspPI	GGNCC	1 cut(s)	116
RseI	CAYNNNNRTG	2 cut(s)	33, 95
SalI	GTCGAC	1 cut(s)	4
Sau3AI	GATC	1 cut(s)	16
Sau96I	GGNCC	1 cut(s)	116
ScrFI	CCNGG	1 cut(s)	114
SetI	ASST	4 cut(s)	11, 28, 125, 175
SgeI	CNNG	9 cut(s)	22, 47, 62, 71, 125, 126, 136, 161, 186
SinI	GGWCC	1 cut(s)	116
SmiMI	CAYNNNNRTG	2 cut(s)	33, 95
Sse9I	AATT	1 cut(s)	38
StyD4I	CCNGG	1 cut(s)	112
StyI	CCWWGG	2 cut(s)	9, 123
TaaI	ACNGT	2 cut(s)	97, 108
TaqI	TCGA	2 cut(s)	5, 175
TasI	AATT	1 cut(s)	38
TscAI	CASTG	3 cut(s)	66, 102, 200
TseFI	GTSAC	2 cut(s)	160, 184
Tsp45I	GTSAC	2 cut(s)	160, 184
TspDTI	ATGAA	1 cut(s)	51
TspRI	CASTG	3 cut(s)	66, 102, 200
Van91I	CCANNNNNTGG	1 cut(s)	195
VpaK11BI	GGWCC	1 cut(s)	116
XapI	RAATTY	1 cut(s)	38
XmiI	GTMKAC	1 cut(s)	5

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.