Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8420245.1

Orthogroup ID

OG0031349

Physical Location & Seq

Genomic Coordinates Reverse (-)

695 .. 1238

Gene Structure 544 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8420245.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 369 bp

atgatcccaaattcacaagcctcctctaggaggcatggttcctcattaccacctccactagaaaagcgtatatatgaagcagataaagatgcaggttttaaggcggtcatcggtctccaggatacttgcagtaaatctacagatgcagtgtttgtcacttccgacatgatggagcgtcaaatcagagagcttcagcaacaaggttctgcttcagctgaaatggagattgagagactaaagcttgagaataaaaaatgcatacaaatggttcagcagtggaagaaaatgtatgacaatttgcaccagttctgtgtaaatgagcttgtcgatggtgataaaggaggagccccaaatggaaatgccccctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000151 GO:0005575 GO:0005622 GO:0005623 GO:0008150 GO:0031461 GO:0032991 GO:0044424 GO:0044464 GO:0048509 GO:0048519 GO:0050789 GO:0050793 GO:0051093 GO:0065007 GO:0080008 GO:1902183 GO:1902184 GO:1902494 GO:1990234

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

WD40

Protein Analysis

122

Amino Acids

13.64

Weight (kDa)

6.11

Isoelectric Point (pI)

46.63

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0031349)

Species	Orthologous Gene IDs
rosa_multiflora	Rmu_co8420245.1_g000001 Rmu_sc0005706.1_g000002

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	83
AciI	CCGC	1 cut(s)	104
AcsI	RAATTY	1 cut(s)	10
AcuI	CTGAAG	2 cut(s)	176, 195
AfiI	CCNNNNNNNGG	2 cut(s)	27, 30
AjnI	CCWGG	1 cut(s)	117
AloI	GAACNNNNNNTCC	2 cut(s)	22, 54
AluBI	AGCT	4 cut(s)	190, 215, 241, 322
AluI	AGCT	4 cut(s)	190, 215, 241, 322
Alw26I	GTCTC	2 cut(s)	119, 226
ApoI	RAATTY	1 cut(s)	10
AsuHPI	GGTGA	1 cut(s)	344
BanII	GRGCYC	1 cut(s)	349
BccI	CCATC	2 cut(s)	163, 323
BciT130I	CCWGG	1 cut(s)	119
BciVI	GTATCC	1 cut(s)	115
BcoDI	GTCTC	2 cut(s)	119, 226
BfaI	CTAG	2 cut(s)	27, 59
BfmI	CTRYAG	1 cut(s)	138
BfuAI	ACCTGC	1 cut(s)	83
BfuI	GTATCC	1 cut(s)	115
Bme1390I	CCNGG	1 cut(s)	119
BmiI	GGNNCC	2 cut(s)	40, 346
BmrFI	CCNGG	1 cut(s)	119
BmsI	GCATC	2 cut(s)	79, 133
BpmI	CTGGAG	1 cut(s)	101
BpuEI	CTTGAG	1 cut(s)	263
BsaI	GGTCTC	1 cut(s)	119
BsaXI	ACNNNNNCTCC	2 cut(s)	22, 52
Bsc4I	CCNNNNNNNGG	2 cut(s)	27, 30
Bse1I	ACTGG	1 cut(s)	304
BseBI	CCWGG	1 cut(s)	119
BseLI	CCNNNNNNNGG	2 cut(s)	27, 30
BseNI	ACTGG	1 cut(s)	304
BseRI	GAGGAG	2 cut(s)	13, 357
BslI	CCNNNNNNNGG	2 cut(s)	27, 30
BsmAI	GTCTC	2 cut(s)	119, 226
Bso31I	GGTCTC	1 cut(s)	119
Bsp1286I	GDGCHC	1 cut(s)	349
Bsp143I	GATC	1 cut(s)	3
BspACI	CCGC	1 cut(s)	104
BspLI	GGNNCC	2 cut(s)	40, 346
BspMI	ACCTGC	1 cut(s)	83
BspTNI	GGTCTC	1 cut(s)	119
BsrI	ACTGG	1 cut(s)	304
BssMI	GATC	1 cut(s)	3
Bst2UI	CCWGG	1 cut(s)	119
BstENI	CCTNNNNNAGG	2 cut(s)	25, 28
BstKTI	GATC	1 cut(s)	6
BstMAI	GTCTC	2 cut(s)	119, 226
BstMBI	GATC	1 cut(s)	3
BstNI	CCWGG	1 cut(s)	119
BstSCI	CCNGG	1 cut(s)	117
BstSFI	CTRYAG	1 cut(s)	138
BsuI	GTATCC	1 cut(s)	115
BtsI	GCAGTG	2 cut(s)	153, 281
BtsIMutI	CAGTG	2 cut(s)	153, 281
BveI	ACCTGC	1 cut(s)	83
CseI	GACGC	1 cut(s)	164
CviAII	CATG	2 cut(s)	35, 166
CviJI	RGCY	6 cut(s)	20, 190, 215, 241, 322, 347
CviKI_1	RGCY	6 cut(s)	20, 190, 215, 241, 322, 347
DpnI	GATC	1 cut(s)	5
DpnII	GATC	1 cut(s)	3
Eco24I	GRGCYC	1 cut(s)	349
Eco31I	GGTCTC	1 cut(s)	119
Eco57I	CTGAAG	2 cut(s)	176, 195
EcoNI	CCTNNNNNAGG	2 cut(s)	25, 28
EcoRII	CCWGG	1 cut(s)	117
EcoT22I	ATGCAT	1 cut(s)	260
EcoT38I	GRGCYC	1 cut(s)	349
FaeI	CATG	2 cut(s)	38, 169
FaiI	YATR	7 cut(s)	36, 71, 73, 75, 167, 260, 291
FatI	CATG	2 cut(s)	34, 165
FriOI	GRGCYC	1 cut(s)	349
FspBI	CTAG	2 cut(s)	27, 59
GsuI	CTGGAG	1 cut(s)	101
HgaI	GACGC	1 cut(s)	164
Hin1II	CATG	2 cut(s)	38, 169
HindIII	AAGCTT	1 cut(s)	239
HphI	GGTGA	1 cut(s)	344
Hpy188I	TCNGA	2 cut(s)	163, 185
HpyCH4V	TGCA	5 cut(s)	92, 129, 146, 258, 301
Hsp92II	CATG	2 cut(s)	38, 169
Kzo9I	GATC	1 cut(s)	3
LmnI	GCTCC	2 cut(s)	172, 344
LpnPI	CCDG	4 cut(s)	78, 104, 131, 317
LweI	GCATC	2 cut(s)	79, 133
MaeI	CTAG	2 cut(s)	27, 59
MaeIII	GTNAC	1 cut(s)	154
MalI	GATC	1 cut(s)	5
MboI	GATC	1 cut(s)	3
MboII	GAAGA	1 cut(s)	292
MhlI	GDGCHC	1 cut(s)	349
MluCI	AATT	2 cut(s)	10, 295
MmeI	TCCRAC	1 cut(s)	186
MnlI	CCTC	6 cut(s)	24, 31, 34, 52, 63, 335
Mph1103I	ATGCAT	1 cut(s)	260
MseI	TTAA	1 cut(s)	99
MslI	CAYNNNNRTG	1 cut(s)	263
MspA1I	CMGCKG	1 cut(s)	215
MspR9I	CCNGG	1 cut(s)	119
MvaI	CCWGG	1 cut(s)	119
NdeII	GATC	1 cut(s)	3
NlaIII	CATG	2 cut(s)	38, 169
NlaIV	GGNNCC	2 cut(s)	40, 346
NmuCI	GTSAC	1 cut(s)	154
NsiI	ATGCAT	1 cut(s)	260
PfoI	TCCNGGA	1 cut(s)	117
Psp6I	CCWGG	1 cut(s)	117
PspGI	CCWGG	1 cut(s)	117
PspN4I	GGNNCC	2 cut(s)	40, 346
PvuII	CAGCTG	1 cut(s)	215
RseI	CAYNNNNRTG	1 cut(s)	263
SaqAI	TTAA	1 cut(s)	99
Sau3AI	GATC	1 cut(s)	3
ScrFI	CCNGG	1 cut(s)	119
SduI	GDGCHC	1 cut(s)	349
SetI	ASST	7 cut(s)	55, 97, 192, 205, 217, 243, 324
SfaNI	GCATC	2 cut(s)	79, 133
SfcI	CTRYAG	1 cut(s)	138
SmiMI	CAYNNNNRTG	1 cut(s)	263
SmlI	CTYRAG	1 cut(s)	242
SmoI	CTYRAG	1 cut(s)	242
Sse9I	AATT	2 cut(s)	10, 295
SsiI	CCGC	1 cut(s)	104
SspMI	CTAG	2 cut(s)	27, 59
StyD4I	CCNGG	1 cut(s)	117
TaqI	TCGA	1 cut(s)	327
TaqII	GACCGA	1 cut(s)	101
TasI	AATT	2 cut(s)	10, 295
Tru1I	TTAA	1 cut(s)	99
Tru9I	TTAA	1 cut(s)	99
TscAI	CASTG	2 cut(s)	153, 281
TseFI	GTSAC	1 cut(s)	154
Tsp45I	GTSAC	1 cut(s)	154
TspDTI	ATGAA	1 cut(s)	90
TspRI	CASTG	2 cut(s)	153, 281
XagI	CCTNNNNNAGG	2 cut(s)	25, 28
XapI	RAATTY	1 cut(s)	10
XspI	CTAG	2 cut(s)	27, 59
Zsp2I	ATGCAT	1 cut(s)	260

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.