Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0005706.1

Orthogroup ID

OG0031349

Physical Location & Seq

Genomic Coordinates Reverse (-)

8225 .. 10637

Gene Structure 2413 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0005706.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 693 bp

atggccaggctccgtcgcggtcgaccaccagaggattggacggcggtaggggtggcttggctattggggtctagggctgctgtcttggctgctcgggtttgggcttgggcgtttgggcttggggcctgggctcaaacttgggttgctgggctaattgataattatcttgagtttggactggcggaagaggtttatggatgcggaactaactcttatttgtttgctgggaagtggctctctgttggtattgcaattgtgcgcctggctaatggggatgctagtccagtgaataatattctagttattagacagcaagtttctcagatgatcccaaattcacaagcctcctctaggaggcatggttcctcattaccacctccactagaaaagcgtatatatgaagcagataaagatgcaggttttaaggcggtcatcggtctccaggatacttgcagtaaatctacagatgcagtgtttgtcacttccgacatgatggagcgtcaaatcagagagcttcagcaacaaggttctgcttcagctgaaatggagattgagagactaaagcttgagaataaaaaatgcatacaaatggttcagcagtggaagaaaatgtatgacaatttgcaccagttctgtgtaaatgagcttgtcgatggtgataaaggaggagccccaaatggaaatgccccctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000151 GO:0005575 GO:0005622 GO:0005623 GO:0008150 GO:0031461 GO:0032991 GO:0044424 GO:0044464 GO:0048509 GO:0048519 GO:0050789 GO:0050793 GO:0051093 GO:0065007 GO:0080008 GO:1902183 GO:1902184 GO:1902494 GO:1990234

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

WD40

Protein Analysis

230

Amino Acids

25.37

Weight (kDa)

7.64

Isoelectric Point (pI)

38.98

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0031349)

Species	Orthologous Gene IDs
rosa_multiflora	Rmu_co8420245.1_g000001 Rmu_sc0005706.1_g000002

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	407
AccI	GTMKAC	1 cut(s)	22
AccII	CGCG	1 cut(s)	18
AciI	CCGC	5 cut(s)	18, 44, 182, 201, 428
AclWI	GGATC	1 cut(s)	322
AcoI	YGGCCR	1 cut(s)	3
AcsI	RAATTY	1 cut(s)	334
AcuI	CTGAAG	2 cut(s)	500, 519
AfiI	CCNNNNNNNGG	2 cut(s)	351, 354
AjnI	CCWGG	4 cut(s)	5, 125, 261, 441
AloI	GAACNNNNNNTCC	2 cut(s)	346, 378
AluBI	AGCT	4 cut(s)	514, 539, 565, 646
AluI	AGCT	4 cut(s)	514, 539, 565, 646
Alw26I	GTCTC	2 cut(s)	443, 550
AlwI	GGATC	1 cut(s)	322
Ama87I	CYCGRG	1 cut(s)	93
AoxI	GGCC	2 cut(s)	3, 123
ApeKI	GCWGC	2 cut(s)	77, 89
ApoI	RAATTY	1 cut(s)	334
AspLEI	GCGC	1 cut(s)	261
AspS9I	GGNCC	1 cut(s)	123
AsuHPI	GGTGA	1 cut(s)	668
AvaI	CYCGRG	1 cut(s)	93
BalI	TGGCCA	1 cut(s)	5
BanII	GRGCYC	2 cut(s)	133, 673
BbvI	GCAGC	2 cut(s)	64, 76
BccI	CCATC	2 cut(s)	487, 647
BceAI	ACGGC	1 cut(s)	57
BciT130I	CCWGG	4 cut(s)	7, 127, 263, 443
BciVI	GTATCC	1 cut(s)	439
BcoDI	GTCTC	2 cut(s)	443, 550
BfaI	CTAG	5 cut(s)	72, 279, 299, 351, 383
BfmI	CTRYAG	1 cut(s)	462
BfuAI	ACCTGC	1 cut(s)	407
BfuI	GTATCC	1 cut(s)	439
BisI	GCNGC	2 cut(s)	78, 90
BlsI	GCNGC	2 cut(s)	79, 91
Bme1390I	CCNGG	4 cut(s)	7, 127, 263, 443
BmeT110I	CYCGRG	1 cut(s)	93
BmgT120I	GGNCC	1 cut(s)	123
BmiI	GGNNCC	4 cut(s)	11, 124, 364, 670
BmrFI	CCNGG	4 cut(s)	7, 127, 263, 443
BmsI	GCATC	4 cut(s)	188, 265, 403, 457
BpmI	CTGGAG	1 cut(s)	425
BpuEI	CTTGAG	2 cut(s)	188, 587
BsaBI	GATNNNNATC	1 cut(s)	162
BsaI	GGTCTC	1 cut(s)	443
BsaJI	CCNNGG	1 cut(s)	126
BsaXI	ACNNNNNCTCC	2 cut(s)	346, 376
Bsc4I	CCNNNNNNNGG	2 cut(s)	351, 354
Bse1I	ACTGG	3 cut(s)	183, 284, 628
Bse8I	GATNNNNATC	1 cut(s)	162
BseBI	CCWGG	4 cut(s)	7, 127, 263, 443
BseDI	CCNNGG	1 cut(s)	126
BseGI	GGATG	2 cut(s)	203, 280
BseJI	GATNNNNATC	1 cut(s)	162
BseLI	CCNNNNNNNGG	2 cut(s)	351, 354
BseMII	CTCAG	1 cut(s)	335
BseNI	ACTGG	3 cut(s)	183, 284, 628
BseRI	GAGGAG	2 cut(s)	337, 681
BseXI	GCAGC	2 cut(s)	64, 76
BseYI	CCCAGC	2 cut(s)	146, 224
Bsh1236I	CGCG	1 cut(s)	18
Bsh1285I	CGRYCG	1 cut(s)	22
BshFI	GGCC	2 cut(s)	5, 125
BsiEI	CGRYCG	1 cut(s)	22
BsiHKCI	CYCGRG	1 cut(s)	93
BslI	CCNNNNNNNGG	2 cut(s)	351, 354
BsmAI	GTCTC	2 cut(s)	443, 550
BsnI	GGCC	2 cut(s)	5, 125
Bso31I	GGTCTC	1 cut(s)	443
BsoBI	CYCGRG	1 cut(s)	93
Bsp1286I	GDGCHC	2 cut(s)	133, 673
Bsp143I	GATC	1 cut(s)	327
BspACI	CCGC	5 cut(s)	18, 44, 182, 201, 428
BspANI	GGCC	2 cut(s)	5, 125
BspCNI	CTCAG	1 cut(s)	334
BspFNI	CGCG	1 cut(s)	18
BspLI	GGNNCC	4 cut(s)	11, 124, 364, 670
BspMI	ACCTGC	1 cut(s)	407
BspPI	GGATC	1 cut(s)	322
BspTNI	GGTCTC	1 cut(s)	443
BsrI	ACTGG	3 cut(s)	183, 284, 628
BssECI	CCNNGG	1 cut(s)	126
BssMI	GATC	1 cut(s)	327
Bst2UI	CCWGG	4 cut(s)	7, 127, 263, 443
Bst6I	CTCTTC	1 cut(s)	180
BstDEI	CTNAG	1 cut(s)	321
BstENI	CCTNNNNNAGG	2 cut(s)	349, 352
BstF5I	GGATG	2 cut(s)	203, 280
BstFNI	CGCG	1 cut(s)	18
BstHHI	GCGC	1 cut(s)	261
BstKTI	GATC	1 cut(s)	330
BstMAI	GTCTC	2 cut(s)	443, 550
BstMBI	GATC	1 cut(s)	327
BstMCI	CGRYCG	1 cut(s)	22
BstMWI	GCNNNNNNNGC	1 cut(s)	86
BstNI	CCWGG	4 cut(s)	7, 127, 263, 443
BstSCI	CCNGG	4 cut(s)	5, 125, 261, 441
BstSFI	CTRYAG	1 cut(s)	462
BstUI	CGCG	1 cut(s)	18
BstV1I	GCAGC	2 cut(s)	64, 76
BstXI	CCANNNNNNTGG	1 cut(s)	36
BsuI	GTATCC	1 cut(s)	439
BsuRI	GGCC	2 cut(s)	5, 125
BtsCI	GGATG	2 cut(s)	203, 280
BtsI	GCAGTG	2 cut(s)	477, 605
BtsIMutI	CAGTG	3 cut(s)	291, 477, 605
BveI	ACCTGC	1 cut(s)	407
CfoI	GCGC	1 cut(s)	261
Cfr13I	GGNCC	1 cut(s)	123
CseI	GACGC	1 cut(s)	488
CviAII	CATG	2 cut(s)	359, 490
DdeI	CTNAG	1 cut(s)	321
DpnI	GATC	1 cut(s)	329
DpnII	GATC	1 cut(s)	327
EaeI	YGGCCR	1 cut(s)	3
Eam1104I	CTCTTC	1 cut(s)	180
EarI	CTCTTC	1 cut(s)	180
EciI	GGCGGA	1 cut(s)	197
Eco24I	GRGCYC	2 cut(s)	133, 673
Eco31I	GGTCTC	1 cut(s)	443
Eco57I	CTGAAG	2 cut(s)	500, 519
Eco88I	CYCGRG	1 cut(s)	93
EcoNI	CCTNNNNNAGG	2 cut(s)	349, 352
EcoO109I	RGGNCCY	1 cut(s)	123
EcoRII	CCWGG	4 cut(s)	5, 125, 261, 441
EcoT22I	ATGCAT	1 cut(s)	584
EcoT38I	GRGCYC	2 cut(s)	133, 673
FaeI	CATG	2 cut(s)	362, 493
FaiI	YATR	8 cut(s)	195, 360, 395, 397, 399, 491, 584, 615
FatI	CATG	2 cut(s)	358, 489
FblI	GTMKAC	1 cut(s)	22
Fnu4HI	GCNGC	2 cut(s)	78, 90
FokI	GGATG	2 cut(s)	210, 287
FriOI	GRGCYC	2 cut(s)	133, 673
Fsp4HI	GCNGC	2 cut(s)	78, 90
FspBI	CTAG	5 cut(s)	72, 279, 299, 351, 383
GlaI	GCGC	1 cut(s)	260
GluI	GCNGC	2 cut(s)	78, 90
GsaI	CCCAGC	2 cut(s)	150, 228
GsuI	CTGGAG	1 cut(s)	425
HaeIII	GGCC	2 cut(s)	5, 125
HgaI	GACGC	1 cut(s)	488
HhaI	GCGC	1 cut(s)	261
Hin1II	CATG	2 cut(s)	362, 493
Hin6I	GCGC	1 cut(s)	259
HinP1I	GCGC	1 cut(s)	259
HincII	GTYRAC	1 cut(s)	23
HindII	GTYRAC	1 cut(s)	23
HindIII	AAGCTT	1 cut(s)	563
HphI	GGTGA	1 cut(s)	668
Hpy166II	GTNNAC	1 cut(s)	23
Hpy188I	TCNGA	3 cut(s)	324, 487, 509
Hpy188III	TCNNGA	1 cut(s)	167
Hpy8I	GTNNAC	1 cut(s)	23
Hpy99I	CGWCG	1 cut(s)	18
HpyCH4V	TGCA	6 cut(s)	251, 416, 453, 470, 582, 625
HpyF10VI	GCNNNNNNNGC	1 cut(s)	86
HpyF3I	CTNAG	1 cut(s)	321
Hsp92II	CATG	2 cut(s)	362, 493
HspAI	GCGC	1 cut(s)	259
Kzo9I	GATC	1 cut(s)	327
LmnI	GCTCC	3 cut(s)	15, 496, 668
Lsp1109I	GCAGC	2 cut(s)	64, 76
LweI	GCATC	4 cut(s)	188, 265, 403, 457
MaeI	CTAG	5 cut(s)	72, 279, 299, 351, 383
MaeIII	GTNAC	1 cut(s)	478
MalI	GATC	1 cut(s)	329
MboI	GATC	1 cut(s)	327
MboII	GAAGA	2 cut(s)	197, 616
MfeI	CAATTG	1 cut(s)	252
MhlI	GDGCHC	2 cut(s)	133, 673
MlsI	TGGCCA	1 cut(s)	5
MluCI	AATT	5 cut(s)	153, 160, 252, 334, 619
MluNI	TGGCCA	1 cut(s)	5
MmeI	TCCRAC	1 cut(s)	510
MnlI	CCTC	8 cut(s)	25, 181, 348, 355, 358, 376, 387, 659
Mox20I	TGGCCA	1 cut(s)	5
Mph1103I	ATGCAT	1 cut(s)	584
MscI	TGGCCA	1 cut(s)	5
MseI	TTAA	1 cut(s)	423
MslI	CAYNNNNRTG	1 cut(s)	587
Msp20I	TGGCCA	1 cut(s)	5
MspA1I	CMGCKG	1 cut(s)	539
MspR9I	CCNGG	4 cut(s)	7, 127, 263, 443
MunI	CAATTG	1 cut(s)	252
MvaI	CCWGG	4 cut(s)	7, 127, 263, 443
MvnI	CGCG	1 cut(s)	18
MwoI	GCNNNNNNNGC	1 cut(s)	86
NdeII	GATC	1 cut(s)	327
NlaIII	CATG	2 cut(s)	362, 493
NlaIV	GGNNCC	4 cut(s)	11, 124, 364, 670
NmuCI	GTSAC	1 cut(s)	478
NsiI	ATGCAT	1 cut(s)	584
PfoI	TCCNGGA	1 cut(s)	441
PkrI	GCNGC	2 cut(s)	79, 91
Psp6I	CCWGG	4 cut(s)	5, 125, 261, 441
PspFI	CCCAGC	2 cut(s)	146, 224
PspGI	CCWGG	4 cut(s)	5, 125, 261, 441
PspN4I	GGNNCC	4 cut(s)	11, 124, 364, 670
PspPI	GGNCC	1 cut(s)	123
PvuII	CAGCTG	1 cut(s)	539
RseI	CAYNNNNRTG	1 cut(s)	587
SalI	GTCGAC	1 cut(s)	21
SaqAI	TTAA	1 cut(s)	423
SatI	GCNGC	2 cut(s)	78, 90
Sau3AI	GATC	1 cut(s)	327
Sau96I	GGNCC	1 cut(s)	123
ScrFI	CCNGG	4 cut(s)	7, 127, 263, 443
SduI	GDGCHC	2 cut(s)	133, 673
SetI	ASST	8 cut(s)	192, 379, 421, 516, 529, 541, 567, 648
SfaNI	GCATC	4 cut(s)	188, 265, 403, 457
SfcI	CTRYAG	1 cut(s)	462
SmiMI	CAYNNNNRTG	1 cut(s)	587
SmlI	CTYRAG	2 cut(s)	167, 566
SmoI	CTYRAG	2 cut(s)	167, 566
Sse9I	AATT	5 cut(s)	153, 160, 252, 334, 619
SsiI	CCGC	5 cut(s)	18, 44, 182, 201, 428
SspI	AATATT	1 cut(s)	295
SspMI	CTAG	5 cut(s)	72, 279, 299, 351, 383
StyD4I	CCNGG	4 cut(s)	5, 125, 261, 441
TaqI	TCGA	2 cut(s)	22, 651
TaqII	GACCGA	1 cut(s)	425
TasI	AATT	5 cut(s)	153, 160, 252, 334, 619
Tru1I	TTAA	1 cut(s)	423
Tru9I	TTAA	1 cut(s)	423
TscAI	CASTG	3 cut(s)	291, 477, 605
TseFI	GTSAC	1 cut(s)	478
TseI	GCWGC	2 cut(s)	77, 89
Tsp45I	GTSAC	1 cut(s)	478
TspDTI	ATGAA	1 cut(s)	414
TspRI	CASTG	3 cut(s)	291, 477, 605
XagI	CCTNNNNNAGG	2 cut(s)	349, 352
XapI	RAATTY	1 cut(s)	334
XcmI	CCANNNNNNNNNTGG	1 cut(s)	33
XmiI	GTMKAC	1 cut(s)	22
XspI	CTAG	5 cut(s)	72, 279, 299, 351, 383
Zsp2I	ATGCAT	1 cut(s)	584

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.