Rmu_co8451561.1_g000001

TPR and ankyrin repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8451561.1
Physical Location & Seq
Forward (+)
1 .. 1673
1673 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8451561.1_g000001.1.cds

Sequence Viewer

Length: 1110 bp
ctatatcatgaacacaactacgaaatggccacaatgtgctttgaaagagcaggtgacacttactgggaaagaaggtctaaagcagctggccttaaagcacttgctgcccatatacgaacgtcaaatcctgaagaggctaaatctattctcagggaagctgctgaaatatttaacgctataggcaaggcagattctgctgccagatgtttttctgatctgggggagtatgaaagagctgctagaatatatttgaaatgtggggagtctgaactaaagagagccgcggaatgtttttctctagcaggacgatataaggaggcagcagatgtctatgctaagggtaattttttcgcagagtgtctcactatttgtgaaaagggaaaactatttgaactgggtttgcagtacatcaataactggaaacagcatgcagatgaggacactgctatgactactagaggaaaaggaataaatagaatgcagcttgaatttttagagagctgtgcacttcactattatgatttgaatgataacagatccatgattaagtttattaaagcttttccttctataactttggtgcgggactttttgaagaggttggatagccttgatgagcttttgttgttggaggaagaatttggaaattatctggaagctgcaaacatcgcacagcttaaaggtgaaattctacttgaatctgatttccttggaaaggcaggtaagttcaaagaagcctcattgaaaataatattctacgtacttgccatgtctctttggtcatctggcagcaagggctggcctctgaagaagtttccacaacaggaggccctcttggcaaaagccaagtcacttgccaagaatgagacagacaactttcatgagttggtttgcactgaggttgatattttattaaataggcaggataacttggcggtgctgaaaaatcaattgaattcttctcagagacaccagagtatcagaggggaagttttatctgctcgaaaaattttggatgcacatctttctcaaagaactgataagagaagattcttcacatatatgaatctgtgcgatgtttggaaactccagaatgcaagggatatgtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

369

Amino Acids

42.23

Weight (kDa)

7.66

Isoelectric Point (pI)

41.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029372)

Species Orthologous Gene IDs
pyrus_communis pycom09g18540
rosa_multiflora Rmu_co8451561.1_g000001

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 41
Acc36I ACCTGC 2 cut(s) 41, 710
AccII CGCG 1 cut(s) 284
AciI CCGC 4 cut(s) 282, 284, 583, 935
AclWI GGATC 1 cut(s) 531
AcoI YGGCCR 1 cut(s) 27
AcsI RAATTY 5 cut(s) 488, 638, 687, 955, 1008
AcuI CTGAAG 2 cut(s) 150, 827
AdeI CACNNNGTG 1 cut(s) 36
AfaI GTAC 2 cut(s) 407, 762
AfiI CCNNNNNNNGG 1 cut(s) 715
AloI GAACNNNNNNTCC 2 cut(s) 109, 141
AluBI AGCT 9 cut(s) 86, 158, 236, 484, 501, 560, 619, 659, 676
AluI AGCT 9 cut(s) 86, 158, 236, 484, 501, 560, 619, 659, 676
Alw21I GWGCWC 1 cut(s) 508
Alw26I GTCTC 4 cut(s) 365, 777, 860, 961
Alw44I GTGCAC 1 cut(s) 504
AlwI GGATC 1 cut(s) 531
AlwNI CAGNNNCTG 1 cut(s) 194
AoxI GGCC 4 cut(s) 27, 88, 800, 828
ApaLI GTGCAC 1 cut(s) 504
ApeKI GCWGC 9 cut(s) 83, 104, 158, 197, 236, 320, 481, 659, 789
ApoI RAATTY 5 cut(s) 488, 638, 687, 955, 1008
ArsI GACNNNNNNTTYG 2 cut(s) 833, 865
AspS9I GGNCC 1 cut(s) 829
AsuHPI GGTGA 2 cut(s) 65, 695
BaeGI GKGCMC 1 cut(s) 508
BaeI ACNNNNGTAYC 2 cut(s) 961, 994
BalI TGGCCA 1 cut(s) 29
Bbv12I GWGCWC 1 cut(s) 508
BbvI GCAGC 9 cut(s) 91, 95, 145, 184, 223, 332, 493, 646, 801
BcoDI GTCTC 4 cut(s) 365, 777, 860, 961
BfaI CTAG 3 cut(s) 240, 299, 456
BfmI CTRYAG 1 cut(s) 177
BfuAI ACCTGC 2 cut(s) 41, 710
BglI GCCNNNNNGGC 1 cut(s) 836
BmgT120I GGNCC 1 cut(s) 829
BmrI ACTGGG 2 cut(s) 73, 404
BmsI GCATC 1 cut(s) 1006
BmuI ACTGGG 2 cut(s) 73, 404
BpmI CTGGAG 1 cut(s) 1073
Bpu10I CCTNAGC 1 cut(s) 336
BsaAI YACGTR 1 cut(s) 760
BsaBI GATNNNNATC 1 cut(s) 1020
BsaJI CCNNGG 2 cut(s) 282, 709
Bsc4I CCNNNNNNNGG 1 cut(s) 715
Bse1I ACTGG 3 cut(s) 68, 399, 422
Bse8I GATNNNNATC 1 cut(s) 1020
BseDI CCNNGG 2 cut(s) 282, 709
BseGI GGATG 1 cut(s) 1021
BseJI GATNNNNATC 1 cut(s) 1020
BseLI CCNNNNNNNGG 1 cut(s) 715
BseMII CTCAG 3 cut(s) 163, 888, 977
BseNI ACTGG 3 cut(s) 68, 399, 422
BseSI GKGCMC 1 cut(s) 508
BseXI GCAGC 9 cut(s) 91, 95, 145, 184, 223, 332, 493, 646, 801
Bsh1236I CGCG 1 cut(s) 284
BshFI GGCC 4 cut(s) 29, 90, 802, 830
BsiHKAI GWGCWC 1 cut(s) 508
BslFI GGGAC 1 cut(s) 599
BslI CCNNNNNNNGG 1 cut(s) 715
BsmAI GTCTC 4 cut(s) 365, 777, 860, 961
BsmFI GGGAC 1 cut(s) 599
BsmI GAATGC 2 cut(s) 483, 1099
BsnI GGCC 4 cut(s) 29, 90, 802, 830
Bsp1286I GDGCHC 1 cut(s) 508
Bsp143I GATC 2 cut(s) 214, 536
BspACI CCGC 4 cut(s) 282, 284, 583, 935
BspANI GGCC 4 cut(s) 29, 90, 802, 830
BspCNI CTCAG 3 cut(s) 162, 889, 976
BspFNI CGCG 1 cut(s) 284
BspHI TCATGA 2 cut(s) 7, 880
BspMI ACCTGC 2 cut(s) 41, 710
BspPI GGATC 1 cut(s) 531
BsrI ACTGG 3 cut(s) 68, 399, 422
BssECI CCNNGG 2 cut(s) 282, 709
BssMI GATC 2 cut(s) 214, 536
BssT1I CCWWGG 1 cut(s) 709
Bst6I CTCTTC 2 cut(s) 126, 590
BstAPI GCANNNNNTGC 2 cut(s) 104, 194
BstBAI YACGTR 1 cut(s) 760
BstC8I GCNNGC 3 cut(s) 88, 429, 800
BstDEI CTNAG 4 cut(s) 149, 336, 897, 963
BstDSI CCRYGG 1 cut(s) 282
BstENI CCTNNNNNAGG 1 cut(s) 713
BstF5I GGATG 1 cut(s) 1021
BstFNI CGCG 1 cut(s) 284
BstKTI GATC 2 cut(s) 217, 539
BstMAI GTCTC 4 cut(s) 365, 777, 860, 961
BstMBI GATC 2 cut(s) 214, 536
BstMWI GCNNNNNNNGC 5 cut(s) 104, 194, 668, 795, 836
BstNSI RCATGY 1 cut(s) 431
BstSFI CTRYAG 1 cut(s) 177
BstSLI GKGCMC 1 cut(s) 508
BstSNI TACGTA 1 cut(s) 760
BstUI CGCG 1 cut(s) 284
BstV1I GCAGC 9 cut(s) 91, 95, 145, 184, 223, 332, 493, 646, 801
BstX2I RGATCY 1 cut(s) 536
BstYI RGATCY 1 cut(s) 536
BsuRI GGCC 4 cut(s) 29, 90, 802, 830
BtgI CCRYGG 1 cut(s) 282
BtgZI GCGATG 2 cut(s) 652, 1089
BtsCI GGATG 1 cut(s) 1021
BtsI GCAGTG 1 cut(s) 441
BtsIMutI CAGTG 2 cut(s) 441, 894
BveI ACCTGC 2 cut(s) 41, 710
Cac8I GCNNGC 3 cut(s) 88, 429, 800
CaiI CAGNNNCTG 1 cut(s) 194
CciI TCATGA 2 cut(s) 7, 880
Cfr13I GGNCC 1 cut(s) 829
Cfr42I CCGCGG 1 cut(s) 285
Csp6I GTAC 2 cut(s) 406, 761
CviAII CATG 5 cut(s) 8, 428, 541, 769, 881
CviQI GTAC 2 cut(s) 406, 761
DdeI CTNAG 4 cut(s) 149, 336, 897, 963
DpnI GATC 2 cut(s) 216, 538
DpnII GATC 2 cut(s) 214, 536
DraIII CACNNNGTG 1 cut(s) 36
EaeI YGGCCR 1 cut(s) 27
Eam1104I CTCTTC 2 cut(s) 126, 590
EarI CTCTTC 2 cut(s) 126, 590
Eco105I TACGTA 1 cut(s) 760
Eco130I CCWWGG 1 cut(s) 709
Eco57I CTGAAG 2 cut(s) 150, 827
EcoNI CCTNNNNNAGG 1 cut(s) 713
EcoO109I RGGNCCY 1 cut(s) 829
EcoRI GAATTC 1 cut(s) 955
EcoT14I CCWWGG 1 cut(s) 709
ErhI CCWWGG 1 cut(s) 709
FaeI CATG 5 cut(s) 11, 431, 544, 772, 884
FaqI GGGAC 1 cut(s) 599
FatI CATG 5 cut(s) 7, 427, 540, 768, 880
FauI CCCGC 1 cut(s) 576
FokI GGATG 1 cut(s) 1028
FspBI CTAG 3 cut(s) 240, 299, 456
GsuI CTGGAG 1 cut(s) 1073
HaeIII GGCC 4 cut(s) 29, 90, 802, 830
Hin1II CATG 5 cut(s) 11, 431, 544, 772, 884
HindIII AAGCTT 1 cut(s) 558
HinfI GANTC 5 cut(s) 191, 263, 698, 1050, 1066
HphI GGTGA 2 cut(s) 65, 695
Hpy166II GTNNAC 1 cut(s) 506
Hpy188I TCNGA 6 cut(s) 214, 268, 703, 807, 966, 983
Hpy188III TCNNGA 5 cut(s) 8, 128, 653, 881, 1090
Hpy8I GTNNAC 1 cut(s) 506
HpyAV CCTTC 2 cut(s) 66, 576
HpyCH4IV ACGT 2 cut(s) 119, 759
HpyCH4V TGCA 8 cut(s) 403, 431, 481, 506, 662, 894, 1019, 1097
HpyF10VI GCNNNNNNNGC 5 cut(s) 104, 194, 668, 795, 836
HpyF3I CTNAG 4 cut(s) 149, 336, 897, 963
HpySE526I ACGT 2 cut(s) 119, 759
Hsp92II CATG 5 cut(s) 11, 431, 544, 772, 884
KspI CCGCGG 1 cut(s) 285
Kzo9I GATC 2 cut(s) 214, 536
Lsp1109I GCAGC 9 cut(s) 91, 95, 145, 184, 223, 332, 493, 646, 801
LweI GCATC 1 cut(s) 1006
MaeI CTAG 3 cut(s) 240, 299, 456
MaeII ACGT 2 cut(s) 119, 759
MaeIII GTNAC 2 cut(s) 53, 849
MalI GATC 2 cut(s) 216, 538
MboI GATC 2 cut(s) 214, 536
MboII GAAGA 7 cut(s) 143, 607, 647, 820, 951, 1045, 1059
MfeI CAATTG 1 cut(s) 950
MflI RGATCY 1 cut(s) 536
MhlI GDGCHC 1 cut(s) 508
MlsI TGGCCA 1 cut(s) 29
MluCI AATT 8 cut(s) 343, 488, 638, 646, 687, 950, 955, 1008
MluNI TGGCCA 1 cut(s) 29
MlyI GAGTC 1 cut(s) 272
MmeI TCCRAC 2 cut(s) 582, 609
Mox20I TGGCCA 1 cut(s) 29
MscI TGGCCA 1 cut(s) 29
MseI TTAA 6 cut(s) 93, 171, 546, 555, 678, 914
MslI CAYNNNNRTG 4 cut(s) 432, 446, 516, 1061
Msp20I TGGCCA 1 cut(s) 29
MspA1I CMGCKG 2 cut(s) 86, 284
MunI CAATTG 1 cut(s) 950
Mva1269I GAATGC 2 cut(s) 483, 1099
MvnI CGCG 1 cut(s) 284
MwoI GCNNNNNNNGC 5 cut(s) 104, 194, 668, 795, 836
NdeII GATC 2 cut(s) 214, 536
NlaIII CATG 5 cut(s) 11, 431, 544, 772, 884
NmuCI GTSAC 2 cut(s) 53, 849
NspI RCATGY 1 cut(s) 431
PaeI GCATGC 1 cut(s) 431
PagI TCATGA 2 cut(s) 7, 880
PaqCI CACCTGC 1 cut(s) 41
PctI GAATGC 2 cut(s) 483, 1099
PfeI GAWTC 4 cut(s) 191, 698, 1050, 1066
PleI GAGTC 1 cut(s) 271
PpsI GAGTC 1 cut(s) 271
Ppu21I YACGTR 1 cut(s) 760
PspPI GGNCC 1 cut(s) 829
PstNI CAGNNNCTG 1 cut(s) 194
PsuI RGATCY 1 cut(s) 536
PvuII CAGCTG 1 cut(s) 86
RsaI GTAC 2 cut(s) 407, 762
RsaNI GTAC 2 cut(s) 406, 761
RseI CAYNNNNRTG 4 cut(s) 432, 446, 516, 1061
SacII CCGCGG 1 cut(s) 285
SaqAI TTAA 6 cut(s) 93, 171, 546, 555, 678, 914
Sau3AI GATC 2 cut(s) 214, 536
Sau96I GGNCC 1 cut(s) 829
SchI GAGTC 1 cut(s) 272
SduI GDGCHC 1 cut(s) 508
SfaNI GCATC 1 cut(s) 1006
SfcI CTRYAG 1 cut(s) 177
Sfr303I CCGCGG 1 cut(s) 285
SgrBI CCGCGG 1 cut(s) 285
SmiMI CAYNNNNRTG 4 cut(s) 432, 446, 516, 1061
SnaBI TACGTA 1 cut(s) 760
SphI GCATGC 1 cut(s) 431
Sse9I AATT 8 cut(s) 343, 488, 638, 646, 687, 950, 955, 1008
SsiI CCGC 4 cut(s) 282, 284, 583, 935
SspI AATATT 2 cut(s) 168, 753
SspMI CTAG 3 cut(s) 240, 299, 456
StyI CCWWGG 1 cut(s) 709
TaiI ACGT 2 cut(s) 122, 762
TaqI TCGA 1 cut(s) 1003
TasI AATT 8 cut(s) 343, 488, 638, 646, 687, 950, 955, 1008
TatI WGTACW 1 cut(s) 405
TauI GCSGC 1 cut(s) 284
TfiI GAWTC 4 cut(s) 191, 698, 1050, 1066
Tru1I TTAA 6 cut(s) 93, 171, 546, 555, 678, 914
Tru9I TTAA 6 cut(s) 93, 171, 546, 555, 678, 914
TscAI CASTG 2 cut(s) 448, 901
TseFI GTSAC 2 cut(s) 53, 849
TseI GCWGC 9 cut(s) 83, 104, 158, 197, 236, 320, 481, 659, 789
Tsp45I GTSAC 2 cut(s) 53, 849
TspDTI ATGAA 4 cut(s) 24, 243, 869, 1079
TspRI CASTG 2 cut(s) 448, 901
VneI GTGCAC 1 cut(s) 504
XagI CCTNNNNNAGG 1 cut(s) 713
XapI RAATTY 5 cut(s) 488, 638, 687, 955, 1008
XceI RCATGY 1 cut(s) 431
XspI CTAG 3 cut(s) 240, 299, 456
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.