Rmu_co8492419.1_g000001

mitogen-activated protein kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8492419.1
Physical Location & Seq
Forward (+)
1 .. 2217
2217 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8492419.1_g000001.1.cds

Sequence Viewer

Length: 516 bp
ggtgttatatgcgcctattggattgttgctttgaaagtttttggatgctttgttactgagatgcagcctgatcaaagaaaaaagtctgtggatgtggacttcttcactgaatatggtgaggggagtaggtataaaatagaggaagtaattggtaaaggaagctatggagttgtttgttctgcgtttgatacgcatactggagaaaaggttattaaagcaaatgatgatttgacaccagaacattatcagttctttctttatcagcttctccgaggaatgaagtacatacacacagcaaatgtttttcaccgagatctaaaacccaaaaacatcttggcaaatgccgactgcaaactgaagatctgcgactttggtctcgctagagtagctttcaatgatactcccacagctatattttggacggactatgttgccacaagatggtacagggctcctgagttgtgtggatcatttttctcaaaggtgcaagaatcattatccctttcactttcttaa

Protein Analysis

171

Amino Acids

19.51

Weight (kDa)

7.05

Isoelectric Point (pI)

16.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0031686)

Species Orthologous Gene IDs
rosa_multiflora Rmu_co8415339.1_g000001 Rmu_co8492419.1_g000001

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 441
AclWI GGATC 1 cut(s) 475
AcuI CTGAAG 1 cut(s) 377
AfaI GTAC 2 cut(s) 284, 446
AfiI CCNNNNNNNGG 1 cut(s) 441
AgsI TTSAA 2 cut(s) 34, 394
AluBI AGCT 4 cut(s) 162, 265, 389, 410
AluI AGCT 4 cut(s) 162, 265, 389, 410
Alw26I GTCTC 1 cut(s) 380
AlwI GGATC 1 cut(s) 475
ApeKI GCWGC 1 cut(s) 64
AspLEI GCGC 1 cut(s) 14
AsuHPI GGTGA 2 cut(s) 128, 299
BanII GRGCYC 1 cut(s) 454
BbvI GCAGC 1 cut(s) 76
BccI CCATC 1 cut(s) 435
BclI TGATCA 1 cut(s) 70
BcoDI GTCTC 1 cut(s) 380
BfaI CTAG 1 cut(s) 381
BglII AGATCT 2 cut(s) 313, 360
BisI GCNGC 1 cut(s) 65
BlsI GCNGC 1 cut(s) 66
BmiI GGNNCC 1 cut(s) 453
BmsI GCATC 2 cut(s) 35, 51
BoxI GACNNNNGTC 1 cut(s) 372
BpmI CTGGAG 1 cut(s) 219
BsaI GGTCTC 1 cut(s) 380
BsaJI CCNNGG 1 cut(s) 271
BsaXI ACNNNNNCTCC 2 cut(s) 192, 222
Bsc4I CCNNNNNNNGG 1 cut(s) 441
Bse1I ACTGG 1 cut(s) 202
BseDI CCNNGG 1 cut(s) 271
BseGI GGATG 2 cut(s) 50, 97
BseLI CCNNNNNNNGG 1 cut(s) 441
BseMII CTCAG 2 cut(s) 48, 447
BseNI ACTGG 1 cut(s) 202
BseXI GCAGC 1 cut(s) 76
BslI CCNNNNNNNGG 1 cut(s) 441
BsmAI GTCTC 1 cut(s) 380
Bso31I GGTCTC 1 cut(s) 380
Bsp1286I GDGCHC 1 cut(s) 454
Bsp143I GATC 4 cut(s) 70, 313, 360, 467
BspCNI CTCAG 2 cut(s) 49, 448
BspLI GGNNCC 1 cut(s) 453
BspPI GGATC 1 cut(s) 475
BspTNI GGTCTC 1 cut(s) 380
BsrI ACTGG 1 cut(s) 202
BssECI CCNNGG 1 cut(s) 271
BssMI GATC 4 cut(s) 70, 313, 360, 467
BstDEI CTNAG 2 cut(s) 57, 456
BstF5I GGATG 2 cut(s) 50, 97
BstHHI GCGC 1 cut(s) 14
BstKTI GATC 4 cut(s) 73, 316, 363, 470
BstMAI GTCTC 1 cut(s) 380
BstMBI GATC 4 cut(s) 70, 313, 360, 467
BstMWI GCNNNNNNNGC 1 cut(s) 386
BstPAI GACNNNNGTC 1 cut(s) 372
BstV1I GCAGC 1 cut(s) 76
BstX2I RGATCY 2 cut(s) 313, 360
BstYI RGATCY 2 cut(s) 313, 360
BtsCI GGATG 2 cut(s) 50, 97
BtsIMutI CAGTG 1 cut(s) 105
CfoI GCGC 1 cut(s) 14
Csp6I GTAC 2 cut(s) 283, 445
CviJI RGCY 6 cut(s) 67, 162, 265, 389, 410, 452
CviKI_1 RGCY 6 cut(s) 67, 162, 265, 389, 410, 452
CviQI GTAC 2 cut(s) 283, 445
DdeI CTNAG 2 cut(s) 57, 456
DpnI GATC 4 cut(s) 72, 315, 362, 469
DpnII GATC 4 cut(s) 70, 313, 360, 467
Eco24I GRGCYC 1 cut(s) 454
Eco31I GGTCTC 1 cut(s) 380
Eco57I CTGAAG 1 cut(s) 377
EcoT38I GRGCYC 1 cut(s) 454
FaiI YATR 9 cut(s) 8, 10, 114, 132, 165, 195, 287, 413, 429
FbaI TGATCA 1 cut(s) 70
Fnu4HI GCNGC 1 cut(s) 65
FokI GGATG 2 cut(s) 57, 104
FriOI GRGCYC 1 cut(s) 454
Fsp4HI GCNGC 1 cut(s) 65
FspBI CTAG 1 cut(s) 381
GlaI GCGC 1 cut(s) 13
GluI GCNGC 1 cut(s) 65
GsuI CTGGAG 1 cut(s) 219
HhaI GCGC 1 cut(s) 14
Hin6I GCGC 1 cut(s) 12
HinP1I GCGC 1 cut(s) 12
HinfI GANTC 1 cut(s) 491
HphI GGTGA 2 cut(s) 128, 299
Hpy166II GTNNAC 1 cut(s) 97
Hpy188I TCNGA 1 cut(s) 272
Hpy188III TCNNGA 1 cut(s) 455
Hpy8I GTNNAC 1 cut(s) 97
HpyCH4V TGCA 3 cut(s) 64, 351, 487
HpyF10VI GCNNNNNNNGC 1 cut(s) 386
HpyF3I CTNAG 2 cut(s) 57, 456
HspAI GCGC 1 cut(s) 12
Ksp22I TGATCA 1 cut(s) 70
Kzo9I GATC 4 cut(s) 70, 313, 360, 467
LmnI GCTCC 1 cut(s) 457
LpnPI CCDG 5 cut(s) 81, 183, 249, 433, 468
Lsp1109I GCAGC 1 cut(s) 76
LweI GCATC 2 cut(s) 35, 51
MaeI CTAG 1 cut(s) 381
MaeIII GTNAC 1 cut(s) 52
MalI GATC 4 cut(s) 72, 315, 362, 469
MboI GATC 4 cut(s) 70, 313, 360, 467
MboII GAAGA 2 cut(s) 94, 370
MflI RGATCY 2 cut(s) 313, 360
MhlI GDGCHC 1 cut(s) 454
MluCI AATT 1 cut(s) 147
MnlI CCTC 3 cut(s) 112, 133, 266
MseI TTAA 2 cut(s) 213, 514
MwoI GCNNNNNNNGC 1 cut(s) 386
NdeII GATC 4 cut(s) 70, 313, 360, 467
NlaIV GGNNCC 1 cut(s) 453
PfeI GAWTC 1 cut(s) 491
PflMI CCANNNNNTGG 1 cut(s) 441
PkrI GCNGC 1 cut(s) 66
PshAI GACNNNNGTC 1 cut(s) 372
PspN4I GGNNCC 1 cut(s) 453
PsuI RGATCY 2 cut(s) 313, 360
RsaI GTAC 2 cut(s) 284, 446
RsaNI GTAC 2 cut(s) 283, 445
SaqAI TTAA 2 cut(s) 213, 514
SatI GCNGC 1 cut(s) 65
Sau3AI GATC 4 cut(s) 70, 313, 360, 467
SduI GDGCHC 1 cut(s) 454
SetI ASST 7 cut(s) 131, 164, 210, 267, 391, 412, 486
SfaNI GCATC 2 cut(s) 35, 51
Sse9I AATT 1 cut(s) 147
SspMI CTAG 1 cut(s) 381
TasI AATT 1 cut(s) 147
TatI WGTACW 1 cut(s) 282
TfiI GAWTC 1 cut(s) 491
Tru1I TTAA 2 cut(s) 213, 514
Tru9I TTAA 2 cut(s) 213, 514
TscAI CASTG 1 cut(s) 112
TseI GCWGC 1 cut(s) 64
TspDTI ATGAA 1 cut(s) 293
TspGWI ACGGA 1 cut(s) 437
TspRI CASTG 1 cut(s) 112
Van91I CCANNNNNTGG 1 cut(s) 441
XcmI CCANNNNNNNNNTGG 1 cut(s) 331
XspI CTAG 1 cut(s) 381
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.