Rmu_co8506547.1_g000001

LRR-repeat protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8506547.1
OG0021511
Physical Location & Seq
Reverse (-)
2262 .. 2993
732 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8506547.1_g000001.1.cds

Sequence Viewer

Length: 648 bp
atgtcaaagcttcaagcaagagttgaagataggttgggtgcactaccagatgaagttatttgtcacgtactttccttcctcgggacaaactgtgctgtgaggaccacgattctgtcaaagaggtggaacaacaaatggactttggttcccaatctagactttgaagacgaggagttctacagacttgttcattttaaaaggtttgttaattggattgaaaagctcaatgctgaacgaaggcgtgatagatatcactctcatatttggcgctggattgacactgccattgggcgtaatcttgttgaacttgacctgaatattgagttctttccagacggaaatgattttgggttacctaggagccttttcgagagtaatacactggaggtattgaagcttgggtcaattgttattatcagttatcttcctatgccaaggaactacttcccaagcctcaagatgctaaatgtttcagttcaccatcctcacaagtattcaatggaaaagtttttttgtcactttccagtacttgaagatttggctatagatggaattcttgggcaaaaggaagatttgaatatcaacatctctgcaccgaaactgaagacgttaagaatatatttgtgggtcaaagatggtgatgactga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
F-box FBD LRR_2

Protein Analysis

215

Amino Acids

25.34

Weight (kDa)

6.71

Isoelectric Point (pI)

58.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021511)

Species Orthologous Gene IDs
rosa_laevigata RLG00000003510
rosa_multiflora Rmu_co8506547.1_g000001
rosa_rugosa Rorug07G0078300
rosa_samantha Rh5AG269700 Rh7AG207900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 552
AcuI CTGAAG 1 cut(s) 623
AfaI GTAC 2 cut(s) 69, 528
AfiI CCNNNNNNNGG 1 cut(s) 81
AgsI TTSAA 9 cut(s) 14, 26, 164, 218, 305, 394, 498, 533, 577
AluBI AGCT 3 cut(s) 10, 223, 397
AluI AGCT 3 cut(s) 10, 223, 397
Alw21I GWGCWC 1 cut(s) 43
Alw44I GTGCAC 1 cut(s) 39
Ama87I CYCGRG 1 cut(s) 80
ApaLI GTGCAC 1 cut(s) 39
ApoI RAATTY 1 cut(s) 552
Asp700I GAANNNNTTC 1 cut(s) 443
AspA2I CCTAGG 1 cut(s) 356
AspLEI GCGC 1 cut(s) 270
AspS9I GGNCC 1 cut(s) 102
AsuHPI GGTGA 1 cut(s) 470
AvaI CYCGRG 1 cut(s) 80
AvaII GGWCC 1 cut(s) 102
AvrII CCTAGG 1 cut(s) 356
BaeGI GKGCMC 1 cut(s) 43
BbsI GAAGAC 2 cut(s) 171, 611
Bbv12I GWGCWC 1 cut(s) 43
BccI CCATC 3 cut(s) 489, 542, 629
BfaI CTAG 2 cut(s) 155, 357
BfmI CTRYAG 2 cut(s) 178, 543
BfoI RGCGCY 1 cut(s) 271
BlnI CCTAGG 1 cut(s) 356
BmcAI AGTACT 1 cut(s) 528
Bme18I GGWCC 1 cut(s) 102
BmeT110I CYCGRG 1 cut(s) 80
BmgT120I GGNCC 1 cut(s) 102
BmiI GGNNCC 2 cut(s) 147, 362
BmsI GCATC 1 cut(s) 450
BpiI GAAGAC 2 cut(s) 171, 611
BpmI CTGGAG 1 cut(s) 404
BpuEI CTTGAG 1 cut(s) 440
BsaAI YACGTR 1 cut(s) 67
BsaBI GATNNNNATC 1 cut(s) 249
BsaJI CCNNGG 3 cut(s) 79, 356, 434
Bsc4I CCNNNNNNNGG 1 cut(s) 81
Bse1I ACTGG 2 cut(s) 387, 524
Bse8I GATNNNNATC 1 cut(s) 249
BseDI CCNNGG 3 cut(s) 79, 356, 434
BseGI GGATG 1 cut(s) 481
BseJI GATNNNNATC 1 cut(s) 249
BseLI CCNNNNNNNGG 1 cut(s) 81
BseNI ACTGG 2 cut(s) 387, 524
BseRI GAGGAG 1 cut(s) 185
BseSI GKGCMC 1 cut(s) 43
BsgI GTGCAG 1 cut(s) 576
BsiHKAI GWGCWC 1 cut(s) 43
BsiHKCI CYCGRG 1 cut(s) 80
BslFI GGGAC 1 cut(s) 97
BslI CCNNNNNNNGG 1 cut(s) 81
BsmFI GGGAC 1 cut(s) 97
BsoBI CYCGRG 1 cut(s) 80
Bsp1286I GDGCHC 1 cut(s) 43
BspLI GGNNCC 2 cut(s) 147, 362
BsrI ACTGG 2 cut(s) 387, 524
BssECI CCNNGG 3 cut(s) 79, 356, 434
BssT1I CCWWGG 2 cut(s) 356, 434
Bst4CI ACNGT 1 cut(s) 92
BstBAI YACGTR 1 cut(s) 67
BstEII GGTNACC 1 cut(s) 351
BstF5I GGATG 1 cut(s) 481
BstH2I RGCGCY 1 cut(s) 271
BstHHI GCGC 1 cut(s) 270
BstPI GGTNACC 1 cut(s) 351
BstSFI CTRYAG 2 cut(s) 178, 543
BstSLI GKGCMC 1 cut(s) 43
BstV2I GAAGAC 2 cut(s) 171, 611
BtsCI GGATG 1 cut(s) 481
BtsI GCAGTG 1 cut(s) 279
BtsIMutI CAGTG 2 cut(s) 279, 380
CfoI GCGC 1 cut(s) 270
Cfr13I GGNCC 1 cut(s) 102
Csp6I GTAC 2 cut(s) 68, 527
CviJI RGCY 6 cut(s) 10, 223, 363, 397, 453, 542
CviKI_1 RGCY 6 cut(s) 10, 223, 363, 397, 453, 542
CviQI GTAC 2 cut(s) 68, 527
DraI TTTAAA 1 cut(s) 196
Eco130I CCWWGG 2 cut(s) 356, 434
Eco32I GATATC 1 cut(s) 251
Eco47I GGWCC 1 cut(s) 102
Eco57I CTGAAG 1 cut(s) 623
Eco88I CYCGRG 1 cut(s) 80
Eco91I GGTNACC 1 cut(s) 351
EcoO65I GGTNACC 1 cut(s) 351
EcoRI GAATTC 1 cut(s) 552
EcoRV GATATC 1 cut(s) 251
EcoT14I CCWWGG 2 cut(s) 356, 434
ErhI CCWWGG 2 cut(s) 356, 434
FaiI YATR 4 cut(s) 261, 431, 545, 619
FaqI GGGAC 1 cut(s) 97
FokI GGATG 1 cut(s) 468
FspBI CTAG 2 cut(s) 155, 357
GlaI GCGC 1 cut(s) 269
GsuI CTGGAG 1 cut(s) 404
HaeII RGCGCY 1 cut(s) 271
HhaI GCGC 1 cut(s) 270
Hin6I GCGC 1 cut(s) 268
HinP1I GCGC 1 cut(s) 268
HindIII AAGCTT 2 cut(s) 8, 395
HinfI GANTC 1 cut(s) 109
HphI GGTGA 1 cut(s) 470
Hpy166II GTNNAC 2 cut(s) 41, 478
Hpy188III TCNNGA 5 cut(s) 82, 155, 332, 370, 457
Hpy8I GTNNAC 2 cut(s) 41, 478
HpyAV CCTTC 2 cut(s) 85, 231
HpyCH4III ACNGT 1 cut(s) 92
HpyCH4IV ACGT 2 cut(s) 66, 608
HpyCH4V TGCA 2 cut(s) 41, 593
HpySE526I ACGT 2 cut(s) 66, 608
HspAI GCGC 1 cut(s) 268
LmnI GCTCC 1 cut(s) 360
LpnPI CCDG 6 cut(s) 60, 256, 326, 345, 368, 537
LweI GCATC 1 cut(s) 450
MaeI CTAG 2 cut(s) 155, 357
MaeII ACGT 2 cut(s) 66, 608
MaeIII GTNAC 3 cut(s) 62, 351, 515
MboII GAAGA 6 cut(s) 38, 176, 416, 545, 581, 616
MfeI CAATTG 1 cut(s) 405
MhlI GDGCHC 1 cut(s) 43
MluCI AATT 3 cut(s) 208, 405, 552
MnlI CCTC 7 cut(s) 89, 93, 114, 163, 379, 464, 495
MroXI GAANNNNTTC 1 cut(s) 443
MseI TTAA 3 cut(s) 195, 207, 611
MunI CAATTG 1 cut(s) 405
NlaIV GGNNCC 2 cut(s) 147, 362
NmuCI GTSAC 2 cut(s) 62, 515
PdmI GAANNNNTTC 1 cut(s) 443
PfeI GAWTC 1 cut(s) 109
Ppu21I YACGTR 1 cut(s) 67
PspEI GGTNACC 1 cut(s) 351
PspN4I GGNNCC 2 cut(s) 147, 362
PspPI GGNCC 1 cut(s) 102
RsaI GTAC 2 cut(s) 69, 528
RsaNI GTAC 2 cut(s) 68, 527
SaqAI TTAA 3 cut(s) 195, 207, 611
Sau96I GGNCC 1 cut(s) 102
ScaI AGTACT 1 cut(s) 528
SduI GDGCHC 1 cut(s) 43
SfaNI GCATC 1 cut(s) 450
SfcI CTRYAG 2 cut(s) 178, 543
SinI GGWCC 1 cut(s) 102
SmlI CTYRAG 1 cut(s) 455
SmoI CTYRAG 1 cut(s) 455
Sse9I AATT 3 cut(s) 208, 405, 552
SspI AATATT 1 cut(s) 319
SspMI CTAG 2 cut(s) 155, 357
StyI CCWWGG 2 cut(s) 356, 434
TaaI ACNGT 1 cut(s) 92
TaiI ACGT 2 cut(s) 69, 611
TaqI TCGA 1 cut(s) 369
TasI AATT 3 cut(s) 208, 405, 552
TatI WGTACW 1 cut(s) 526
TfiI GAWTC 1 cut(s) 109
Tru1I TTAA 3 cut(s) 195, 207, 611
Tru9I TTAA 3 cut(s) 195, 207, 611
TscAI CASTG 2 cut(s) 286, 387
TseFI GTSAC 2 cut(s) 62, 515
Tsp45I GTSAC 2 cut(s) 62, 515
TspDTI ATGAA 2 cut(s) 66, 179
TspGWI ACGGA 1 cut(s) 351
TspRI CASTG 2 cut(s) 286, 387
VneI GTGCAC 1 cut(s) 39
VpaK11BI GGWCC 1 cut(s) 102
XapI RAATTY 1 cut(s) 552
XbaI TCTAGA 1 cut(s) 154
XmaJI CCTAGG 1 cut(s) 356
XmnI GAANNNNTTC 1 cut(s) 443
XspI CTAG 2 cut(s) 155, 357
ZrmI AGTACT 1 cut(s) 528
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.