Rh5AG269700

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
OG0021511
Physical Location & Seq
Forward (+)
35739370 .. 35739999
630 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG269700.1

Sequence Viewer

Length: 630 bp
ATGGATTCAATGTCAAAGCTTCAAGCAAGAGTTGAAGATAGGTTGAGTGCACTACCAGATGAAGTTATTTGTCACATACTTTCTTTCTTTGGGACAAAATGTGCTGTGAGGACCACGATTCTGTCAAAGAGGTGGAACAACAAATGGACTTTGGTTCCCAATCTAGACTTCGACGACGAGGAGTTCTACAGACTTGTTCATTTTAAAAGGTTTGTTAATTGGGTCCTTGACTTTCGTGGCTCATCAAACATCCAAAAGCTCAAACTTGAATGTTCGCTTGATATCGAGTTTGAGTGGGAATCATACATTGAAAAGCTCAATGCTGAACGAAGGCGTGATAGATATCACTCTCATATTTGGTGCTGGATTGACACTGCCATTGGGCGTAATCTTGTTGAACTTGACCTGAATATTGAGTTCTTTCCAGACGGAAATGTTTTTGGGTTACCTAGGAGCCTTTTCGAGAGTATTACACTAGAGGTATTGAAGCTTGGGTCAAATTTTATTATCGGTCATCTTCCTATGCCAAGGAACTACTTCCCAAACCTCAAGATGCTAAATGTTTCAGTTCACCATCCTCGCAAGTATTCAATGGAAAAGTTTTTTTCTCACTTGAAGATTTGGTTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
F-box FBD LRR_2

Protein Analysis

209

Amino Acids

24.97

Weight (kDa)

7.73

Isoelectric Point (pI)

54.82

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
F-box PF00646 15 - 53 1.9e-06 F-box domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021511)

Species Orthologous Gene IDs
rosa_laevigata RLG00000003510
rosa_multiflora Rmu_co8506547.1_g000001
rosa_rugosa Rorug07G0078300
rosa_samantha Rh5AG269700 Rh7AG207900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 628
AcsI RAATTY 1 cut(s) 499
AgsI TTSAA 9 cut(s) 9, 23, 35, 269, 311, 398, 487, 591, 616
AjuI GAANNNNNNNTTGG 2 cut(s) 152, 184
AluBI AGCT 4 cut(s) 19, 259, 316, 490
AluI AGCT 4 cut(s) 19, 259, 316, 490
Alw21I GWGCWC 1 cut(s) 52
Alw44I GTGCAC 1 cut(s) 48
ApaLI GTGCAC 1 cut(s) 48
ApoI RAATTY 1 cut(s) 499
Asp700I GAANNNNTTC 1 cut(s) 536
AspA2I CCTAGG 1 cut(s) 449
AspS9I GGNCC 2 cut(s) 111, 223
AsuHPI GGTGA 1 cut(s) 563
AvaII GGWCC 2 cut(s) 111, 223
AvrII CCTAGG 1 cut(s) 449
BaeGI GKGCMC 1 cut(s) 52
Bbv12I GWGCWC 1 cut(s) 52
BccI CCATC 1 cut(s) 582
BfaI CTAG 3 cut(s) 164, 450, 476
BfmI CTRYAG 1 cut(s) 187
BlnI CCTAGG 1 cut(s) 449
Bme18I GGWCC 2 cut(s) 111, 223
BmgT120I GGNCC 2 cut(s) 111, 223
BmiI GGNNCC 3 cut(s) 156, 224, 455
BmsI GCATC 1 cut(s) 543
BpuEI CTTGAG 1 cut(s) 533
BsaBI GATNNNNATC 1 cut(s) 342
BsaJI CCNNGG 2 cut(s) 449, 527
Bse8I GATNNNNATC 1 cut(s) 342
BseDI CCNNGG 2 cut(s) 449, 527
BseGI GGATG 2 cut(s) 249, 574
BseJI GATNNNNATC 1 cut(s) 342
BseRI GAGGAG 1 cut(s) 194
BseSI GKGCMC 1 cut(s) 52
BsiHKAI GWGCWC 1 cut(s) 52
BslFI GGGAC 1 cut(s) 106
BsmFI GGGAC 1 cut(s) 106
Bsp1286I GDGCHC 1 cut(s) 52
BspLI GGNNCC 3 cut(s) 156, 224, 455
BssECI CCNNGG 2 cut(s) 449, 527
BssT1I CCWWGG 2 cut(s) 449, 527
BstEII GGTNACC 1 cut(s) 444
BstF5I GGATG 2 cut(s) 249, 574
BstPI GGTNACC 1 cut(s) 444
BstSFI CTRYAG 1 cut(s) 187
BstSLI GKGCMC 1 cut(s) 52
BtsCI GGATG 2 cut(s) 249, 574
BtsI GCAGTG 1 cut(s) 372
BtsIMutI CAGTG 1 cut(s) 372
Cfr13I GGNCC 2 cut(s) 111, 223
CviJI RGCY 6 cut(s) 19, 240, 259, 316, 456, 490
CviKI_1 RGCY 6 cut(s) 19, 240, 259, 316, 456, 490
DraI TTTAAA 1 cut(s) 205
Eco130I CCWWGG 2 cut(s) 449, 527
Eco32I GATATC 2 cut(s) 283, 344
Eco47I GGWCC 2 cut(s) 111, 223
Eco91I GGTNACC 1 cut(s) 444
EcoO109I RGGNCCY 1 cut(s) 223
EcoO65I GGTNACC 1 cut(s) 444
EcoRV GATATC 2 cut(s) 283, 344
EcoT14I CCWWGG 2 cut(s) 449, 527
ErhI CCWWGG 2 cut(s) 449, 527
FaiI YATR 5 cut(s) 77, 304, 354, 524, 628
FaqI GGGAC 1 cut(s) 106
FokI GGATG 2 cut(s) 236, 561
FspBI CTAG 3 cut(s) 164, 450, 476
HindIII AAGCTT 2 cut(s) 17, 488
HinfI GANTC 3 cut(s) 5, 118, 299
HphI GGTGA 1 cut(s) 563
Hpy166II GTNNAC 2 cut(s) 50, 571
Hpy188III TCNNGA 4 cut(s) 164, 425, 463, 550
Hpy8I GTNNAC 2 cut(s) 50, 571
Hpy99I CGWCG 2 cut(s) 176, 179
HpyAV CCTTC 1 cut(s) 324
HpyCH4V TGCA 1 cut(s) 50
LmnI GCTCC 1 cut(s) 453
LpnPI CCDG 4 cut(s) 69, 349, 419, 438
LweI GCATC 1 cut(s) 543
MaeI CTAG 3 cut(s) 164, 450, 476
MaeIII GTNAC 2 cut(s) 71, 444
MboII GAAGA 3 cut(s) 47, 509, 628
MhlI GDGCHC 1 cut(s) 52
MluCI AATT 2 cut(s) 217, 499
MnlI CCTC 6 cut(s) 102, 123, 172, 472, 557, 588
MroXI GAANNNNTTC 1 cut(s) 536
MseI TTAA 2 cut(s) 204, 216
NlaIV GGNNCC 3 cut(s) 156, 224, 455
NmuCI GTSAC 1 cut(s) 71
PdmI GAANNNNTTC 1 cut(s) 536
PfeI GAWTC 3 cut(s) 5, 118, 299
PpuMI RGGWCCY 1 cut(s) 223
PsiI TTATAA 1 cut(s) 628
Psp5II RGGWCCY 1 cut(s) 223
PspEI GGTNACC 1 cut(s) 444
PspN4I GGNNCC 3 cut(s) 156, 224, 455
PspPI GGNCC 2 cut(s) 111, 223
PspPPI RGGWCCY 1 cut(s) 223
SaqAI TTAA 2 cut(s) 204, 216
Sau96I GGNCC 2 cut(s) 111, 223
SduI GDGCHC 1 cut(s) 52
SfaNI GCATC 1 cut(s) 543
SfcI CTRYAG 1 cut(s) 187
SinI GGWCC 2 cut(s) 111, 223
SmlI CTYRAG 1 cut(s) 548
SmoI CTYRAG 1 cut(s) 548
Sse9I AATT 2 cut(s) 217, 499
SspI AATATT 1 cut(s) 412
SspMI CTAG 3 cut(s) 164, 450, 476
StyI CCWWGG 2 cut(s) 449, 527
TaqI TCGA 3 cut(s) 171, 285, 462
TaqII GACCGA 1 cut(s) 500
TasI AATT 2 cut(s) 217, 499
TfiI GAWTC 3 cut(s) 5, 118, 299
Tru1I TTAA 2 cut(s) 204, 216
Tru9I TTAA 2 cut(s) 204, 216
TscAI CASTG 1 cut(s) 379
TseFI GTSAC 1 cut(s) 71
Tsp45I GTSAC 1 cut(s) 71
TspDTI ATGAA 2 cut(s) 75, 188
TspGWI ACGGA 1 cut(s) 444
TspRI CASTG 1 cut(s) 379
VneI GTGCAC 1 cut(s) 48
VpaK11BI GGWCC 2 cut(s) 111, 223
XapI RAATTY 1 cut(s) 499
XbaI TCTAGA 1 cut(s) 163
XmaJI CCTAGG 1 cut(s) 449
XmnI GAANNNNTTC 1 cut(s) 536
XspI CTAG 3 cut(s) 164, 450, 476
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.