Rmu_co8511045.1_g000001

disease resistance protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8511045.1
OG0025487
Physical Location & Seq
Forward (+)
1 .. 1446
1446 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8511045.1_g000001.1.cds

Sequence Viewer

Length: 1290 bp
tcatcaccaaaacttgcttctgctgattctacacaagcagaggcacttctcaaatggaaagccagctttctgaatcaaacctggaataacaatctcacctcgtggacttccctccccggaaacgccaccaattcatcaactgcatgcaatgtttggaccggtatttcatgcaatgctgccggaagtgtcaaccggataaacctcaccaaatctggtataaaagacaccatcccacctcagattagttccctctccaaactcttctaccttgatgtatcttataatcaattgactgggatcatcccaccagaaattggtctcctaacatatcttcaagtcctccacttaaacggaaaccagttaaatggctcgattcctgaagaaatgagccagctcaaatctctttatgagcttgctctgaacaccaacaatctagaaggttctattccagccttcctgggtaattttaccaacatgacaaattcgtatctctttggaaatcagctttctggtgtcattcctcctgaaattggaaacctatcaaaattggttgaattgtgcttggatcacaaccatttaacaggtcccatccctccaagttttggaaacttggaaaatccatctctgctttcaatccacaagcctgctgctgcagtcaatgttgaacaacataatccacgacctataacttcatcttccatcgatatatcgaccgtatttgggcgacaagctgaaaaggagaggttggtgagtgagttgttaagggaggggaggtctggacttgtcatcctcattgtagggatgggaggattgggaaagacaacttttactcaattagtctttaaggatgcacaagttcaagcccattttgatatcaaagcttgggtttgtgcctcagacccttttgatgtcatcaagattgcaaaagatatccttgaacttgtcagtggaataaaatctcaagatagttcaaatgtggtgcaaaaattgttagaaagcatccaagaaagaatcaagggcaacaagtttctcctcgtgctagattatgtgtggagggaagaccaaacaaagtgggagagtttaaggttaccggtactaatgcaaacctgttctgaaggcagtagaattcttgtgaccactcgaacgcaggaggttgctcgaatgatgagagcaaccagggacatgatcactttggagaagttgagtcatatagattctttggaactattctataatgttgcatttctggatagggaacaagaccaacaaggggtttggagatattgctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LRR_8 NB-ARC

Protein Analysis

429

Amino Acids

47.49

Weight (kDa)

6.03

Isoelectric Point (pI)

30.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0025487)

Species Orthologous Gene IDs
rosa_multiflora Rmu_co8511045.1_g000001 Rmu_sc0000721.1_g000008 Rmu_sc0005913.1_g000024

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 282
AccB7I CCANNNNNTGG 2 cut(s) 314, 602
AclWI GGATC 2 cut(s) 305, 573
AcsI RAATTY 2 cut(s) 481, 1125
AcuI CTGAAG 2 cut(s) 399, 1134
AdeI CACNNNGTG 1 cut(s) 102
AfaI GTAC 1 cut(s) 1095
AfiI CCNNNNNNNGG 5 cut(s) 314, 530, 602, 720, 1270
AgeI ACCGGT 2 cut(s) 158, 1090
AgsI TTSAA 7 cut(s) 335, 554, 633, 665, 860, 938, 972
AjnI CCWGG 3 cut(s) 80, 456, 1175
AjuI GAANNNNNNNTTGG 1 cut(s) 33
AluBI AGCT 6 cut(s) 66, 394, 412, 505, 731, 881
AluI AGCT 6 cut(s) 66, 394, 412, 505, 731, 881
Alw26I GTCTC 1 cut(s) 323
AlwI GGATC 2 cut(s) 305, 573
ApeKI GCWGC 3 cut(s) 176, 647, 650
ApoI RAATTY 2 cut(s) 481, 1125
AsiGI ACCGGT 2 cut(s) 158, 1090
AspS9I GGNCC 2 cut(s) 156, 584
AsuC2I CCSGG 1 cut(s) 117
AsuHPI GGTGA 3 cut(s) 88, 196, 760
AvaII GGWCC 2 cut(s) 156, 584
BauI CACGAG 2 cut(s) 100, 1034
BbsI GAAGAC 1 cut(s) 1065
BbvI GCAGC 3 cut(s) 163, 634, 637
BccI CCATC 5 cut(s) 236, 596, 628, 707, 796
BciT130I CCWGG 3 cut(s) 82, 458, 1177
BclI TGATCA 1 cut(s) 1185
BcnI CCSGG 1 cut(s) 117
BcoDI GTCTC 1 cut(s) 323
BfaI CTAG 2 cut(s) 434, 1040
BfmI CTRYAG 1 cut(s) 651
BisI GCNGC 3 cut(s) 177, 648, 651
BlsI GCNGC 3 cut(s) 178, 649, 652
Bme1390I CCNGG 4 cut(s) 82, 117, 458, 1177
Bme18I GGWCC 2 cut(s) 156, 584
BmgT120I GGNCC 2 cut(s) 156, 584
BmiI GGNNCC 1 cut(s) 586
BmrFI CCNGG 4 cut(s) 82, 117, 458, 1177
BmrI ACTGGG 1 cut(s) 303
BmsI GCATC 2 cut(s) 838, 1008
BmuI ACTGGG 1 cut(s) 303
BpiI GAAGAC 1 cut(s) 1065
BpuEI CTTGAG 1 cut(s) 945
BpuMI CCSGG 1 cut(s) 117
Bsa29I ATCGAT 1 cut(s) 702
BsaI GGTCTC 1 cut(s) 323
BsaJI CCNNGG 3 cut(s) 115, 457, 1176
BsaWI WCCGGW 3 cut(s) 158, 192, 1090
BsaXI ACNNNNNCTCC 2 cut(s) 758, 788
Bsc4I CCNNNNNNNGG 5 cut(s) 314, 530, 602, 720, 1270
Bse118I RCCGGY 2 cut(s) 158, 1090
Bse1I ACTGG 2 cut(s) 298, 358
Bse3DI GCAATG 2 cut(s) 154, 178
BseBI CCWGG 3 cut(s) 82, 458, 1177
BseCI ATCGAT 1 cut(s) 702
BseDI CCNNGG 3 cut(s) 115, 457, 1176
BseGI GGATG 7 cut(s) 228, 300, 588, 786, 807, 853, 999
BseLI CCNNNNNNNGG 5 cut(s) 314, 530, 602, 720, 1270
BseMI GCAATG 2 cut(s) 154, 178
BseMII CTCAG 2 cut(s) 251, 909
BseNI ACTGG 2 cut(s) 298, 358
BseRI GAGGAG 1 cut(s) 1022
BseXI GCAGC 3 cut(s) 163, 634, 637
Bsh1285I CGRYCG 1 cut(s) 714
BshTI ACCGGT 2 cut(s) 158, 1090
BshVI ATCGAT 1 cut(s) 702
BsiEI CGRYCG 1 cut(s) 714
BsiSI CCGG 5 cut(s) 117, 159, 180, 193, 1091
BslFI GGGAC 2 cut(s) 570, 1193
BslI CCNNNNNNNGG 5 cut(s) 314, 530, 602, 720, 1270
BsmAI GTCTC 1 cut(s) 323
BsmFI GGGAC 2 cut(s) 570, 1193
Bso31I GGTCTC 1 cut(s) 323
Bsp143I GATC 3 cut(s) 297, 565, 1185
BspCNI CTCAG 2 cut(s) 250, 908
BspDI ATCGAT 1 cut(s) 702
BspLI GGNNCC 1 cut(s) 586
BspMAI CTGCAG 1 cut(s) 655
BspPI GGATC 2 cut(s) 305, 573
BspTNI GGTCTC 1 cut(s) 323
BsrDI GCAATG 2 cut(s) 154, 178
BsrFI RCCGGY 2 cut(s) 158, 1090
BsrI ACTGG 2 cut(s) 298, 358
BssAI RCCGGY 2 cut(s) 158, 1090
BssECI CCNNGG 3 cut(s) 115, 457, 1176
BssMI GATC 3 cut(s) 297, 565, 1185
BssSI CACGAG 2 cut(s) 100, 1034
Bst2BI CACGAG 2 cut(s) 100, 1034
Bst2UI CCWGG 3 cut(s) 82, 458, 1177
Bst4CI ACNGT 1 cut(s) 715
Bst6I CTCTTC 1 cut(s) 266
BstC8I GCNNGC 5 cut(s) 64, 145, 392, 414, 645
BstDEI CTNAG 2 cut(s) 237, 895
BstEII GGTNACC 1 cut(s) 1086
BstF5I GGATG 7 cut(s) 228, 300, 588, 786, 807, 853, 999
BstKTI GATC 3 cut(s) 300, 568, 1188
BstMAI GTCTC 1 cut(s) 323
BstMBI GATC 3 cut(s) 297, 565, 1185
BstMCI CGRYCG 1 cut(s) 714
BstNI CCWGG 3 cut(s) 82, 458, 1177
BstNSI RCATGY 1 cut(s) 147
BstPI GGTNACC 1 cut(s) 1086
BstSCI CCNGG 4 cut(s) 80, 115, 456, 1175
BstSFI CTRYAG 1 cut(s) 651
BstV1I GCAGC 3 cut(s) 163, 634, 637
BstV2I GAAGAC 1 cut(s) 1065
BstXI CCANNNNNNTGG 1 cut(s) 365
Bsu15I ATCGAT 1 cut(s) 702
BsuTUI ATCGAT 1 cut(s) 702
BtsCI GGATG 7 cut(s) 228, 300, 588, 786, 807, 853, 999
BtsIMutI CAGTG 1 cut(s) 952
Cac8I GCNNGC 5 cut(s) 64, 145, 392, 414, 645
Cfr10I RCCGGY 2 cut(s) 158, 1090
Cfr13I GGNCC 2 cut(s) 156, 584
ClaI ATCGAT 1 cut(s) 702
Csp6I GTAC 1 cut(s) 1094
CspAI ACCGGT 2 cut(s) 158, 1090
CspCI CAANNNNNGTGG 2 cut(s) 1052, 1087
CviAII CATG 4 cut(s) 144, 168, 475, 1183
CviQI GTAC 1 cut(s) 1094
DdeI CTNAG 2 cut(s) 237, 895
DpnI GATC 3 cut(s) 299, 567, 1187
DpnII GATC 3 cut(s) 297, 565, 1185
DraIII CACNNNGTG 1 cut(s) 102
Eam1104I CTCTTC 1 cut(s) 266
EarI CTCTTC 1 cut(s) 266
Eco31I GGTCTC 1 cut(s) 323
Eco32I GATATC 2 cut(s) 874, 931
Eco47I GGWCC 2 cut(s) 156, 584
Eco57I CTGAAG 2 cut(s) 399, 1134
Eco91I GGTNACC 1 cut(s) 1086
EcoO109I RGGNCCY 1 cut(s) 584
EcoO65I GGTNACC 1 cut(s) 1086
EcoRI GAATTC 1 cut(s) 1125
EcoRII CCWGG 3 cut(s) 80, 456, 1175
EcoRV GATATC 2 cut(s) 874, 931
FaeI CATG 4 cut(s) 147, 171, 478, 1186
FalI AAGNNNNNCTT 2 cut(s) 918, 950
FaqI GGGAC 2 cut(s) 570, 1193
FatI CATG 4 cut(s) 143, 167, 474, 1182
FbaI TGATCA 1 cut(s) 1185
Fnu4HI GCNGC 3 cut(s) 177, 648, 651
FokI GGATG 7 cut(s) 215, 287, 575, 773, 814, 860, 986
Fsp4HI GCNGC 3 cut(s) 177, 648, 651
FspBI CTAG 2 cut(s) 434, 1040
GluI GCNGC 3 cut(s) 177, 648, 651
HapII CCGG 5 cut(s) 117, 159, 180, 193, 1091
Hin1II CATG 4 cut(s) 147, 171, 478, 1186
HincII GTYRAC 1 cut(s) 190
HindII GTYRAC 1 cut(s) 190
HindIII AAGCTT 1 cut(s) 879
HinfI GANTC 6 cut(s) 26, 73, 373, 1011, 1204, 1214
HpaII CCGG 5 cut(s) 117, 159, 180, 193, 1091
HphI GGTGA 3 cut(s) 88, 196, 760
Hpy166II GTNNAC 2 cut(s) 105, 190
Hpy188I TCNGA 5 cut(s) 72, 240, 420, 898, 1114
Hpy188III TCNNGA 7 cut(s) 377, 434, 524, 777, 916, 962, 1247
Hpy8I GTNNAC 2 cut(s) 105, 190
HpyAV CCTTC 3 cut(s) 431, 463, 1109
HpyCH4III ACNGT 1 cut(s) 715
HpyCH4V TGCA 9 cut(s) 143, 147, 171, 653, 851, 923, 982, 1102, 1241
HpyF3I CTNAG 2 cut(s) 237, 895
Hsp92II CATG 4 cut(s) 147, 171, 478, 1186
Ksp22I TGATCA 1 cut(s) 1185
Kzo9I GATC 3 cut(s) 297, 565, 1185
Lsp1109I GCAGC 3 cut(s) 163, 634, 637
LweI GCATC 2 cut(s) 838, 1008
MaeI CTAG 2 cut(s) 434, 1040
MaeIII GTNAC 2 cut(s) 1086, 1132
MalI GATC 3 cut(s) 299, 567, 1187
MboI GATC 3 cut(s) 297, 565, 1185
MboII GAAGA 5 cut(s) 253, 323, 392, 687, 1070
MfeI CAATTG 1 cut(s) 287
MlyI GAGTC 1 cut(s) 1213
MseI TTAA 6 cut(s) 347, 362, 578, 761, 843, 1082
MspI CCGG 5 cut(s) 117, 159, 180, 193, 1091
MspR9I CCNGG 4 cut(s) 82, 117, 458, 1177
MunI CAATTG 1 cut(s) 287
MvaI CCWGG 3 cut(s) 82, 458, 1177
NciI CCSGG 1 cut(s) 117
NdeII GATC 3 cut(s) 297, 565, 1185
NlaIII CATG 4 cut(s) 147, 171, 478, 1186
NlaIV GGNNCC 1 cut(s) 586
NmuCI GTSAC 1 cut(s) 1132
NspI RCATGY 1 cut(s) 147
PaeI GCATGC 1 cut(s) 147
PfeI GAWTC 5 cut(s) 26, 73, 373, 1011, 1214
PflMI CCANNNNNTGG 2 cut(s) 314, 602
PinAI ACCGGT 2 cut(s) 158, 1090
PkrI GCNGC 3 cut(s) 178, 649, 652
PleI GAGTC 1 cut(s) 1212
PpsI GAGTC 1 cut(s) 1212
PpuMI RGGWCCY 1 cut(s) 584
PsiI TTATAA 1 cut(s) 282
Psp5II RGGWCCY 1 cut(s) 584
Psp6I CCWGG 3 cut(s) 80, 456, 1175
PspEI GGTNACC 1 cut(s) 1086
PspGI CCWGG 3 cut(s) 80, 456, 1175
PspN4I GGNNCC 1 cut(s) 586
PspPI GGNCC 2 cut(s) 156, 584
PspPPI RGGWCCY 1 cut(s) 584
PstI CTGCAG 1 cut(s) 655
RsaI GTAC 1 cut(s) 1095
RsaNI GTAC 1 cut(s) 1094
SaqAI TTAA 6 cut(s) 347, 362, 578, 761, 843, 1082
SatI GCNGC 3 cut(s) 177, 648, 651
Sau3AI GATC 3 cut(s) 297, 565, 1185
Sau96I GGNCC 2 cut(s) 156, 584
SchI GAGTC 1 cut(s) 1213
ScrFI CCNGG 4 cut(s) 82, 117, 458, 1177
SfaNI GCATC 2 cut(s) 838, 1008
SfcI CTRYAG 1 cut(s) 651
SinI GGWCC 2 cut(s) 156, 584
SmlI CTYRAG 1 cut(s) 960
SmoI CTYRAG 1 cut(s) 960
SphI GCATGC 1 cut(s) 147
SspMI CTAG 2 cut(s) 434, 1040
StyD4I CCNGG 4 cut(s) 80, 115, 456, 1175
TaaI ACNGT 1 cut(s) 715
TaqI TCGA 5 cut(s) 371, 702, 710, 1141, 1159
TfiI GAWTC 5 cut(s) 26, 73, 373, 1011, 1214
Tru1I TTAA 6 cut(s) 347, 362, 578, 761, 843, 1082
Tru9I TTAA 6 cut(s) 347, 362, 578, 761, 843, 1082
TscAI CASTG 1 cut(s) 952
TseFI GTSAC 1 cut(s) 1132
TseI GCWGC 3 cut(s) 176, 647, 650
Tsp45I GTSAC 1 cut(s) 1132
TspDTI ATGAA 3 cut(s) 123, 156, 681
TspGWI ACGGA 1 cut(s) 366
TspRI CASTG 1 cut(s) 952
Van91I CCANNNNNTGG 2 cut(s) 314, 602
VpaK11BI GGWCC 2 cut(s) 156, 584
XapI RAATTY 2 cut(s) 481, 1125
XbaI TCTAGA 1 cut(s) 433
XceI RCATGY 1 cut(s) 147
XspI CTAG 2 cut(s) 434, 1040
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.