Rmu_sc0000721.1_g000008

disease resistance protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000721.1
OG0025487
Physical Location & Seq
Reverse (-)
28808 .. 30322
1515 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000721.1_g000008.1.cds

Sequence Viewer

Length: 1359 bp
atgaaaccttctacttacttggattatgtctgctctctagcttgcattatcttgttccttcagttggtttcatcaccaaaacttgcttctgctgattctacacaagcagaggcacttctcaaatggaaagccagctttctgaatcaaacctggaataacaatctcacctcgtggacttccctccccggaaacgccaccaattcatcaactgcatgcaatgtttggaccggtatttcatgcaatgctgccggaagtgtcaaccggataaacctcaccaaatctggtataaaagacaccatcccacctcagattagttccctctccaaactcttctaccttgatgtatcttataatcaattgactgggatcatcccaccagaaattggtctcctaacatatcttcaagtcctccacttaaacggaaaccagttaaatggctcgattcctgaagaaatgagccagctcaaatctctttatgagcttgctctgaacaccaacaatctagaaggttctattccagccttcctgggtaattttaccaacatgacaaattcgtatctctttggaaatcagctttctggtgtcattcctcctgaaattggaaacctatcaaaattggttgaattgtgcttggatcacaaccatttaacaggtcccatccctccaagttttggaaacttggaaaatccatctctgctttcaatccacaagcctgctgctgcagtcaatgttgaacaacataatccacgacctataacttcatcttccatcgatatatcgaccgtatttgggcgacaagctgaaaaggagaggttggtgagtgagttgttaagggaggggaggtctggacttgtcatcctcattgtagggatgggaggattgggaaagacaacttttactcaattagtctttaaggatgcacaagttcaagcccattttgatatcaaagcttgggtttgtgcctcagacccttttgatgtcatcaagattgcaaaagatatccttgaacttgtcagtggaataaaatctcaagatagttcaaatgtggtgcaaaaattgttagaaagcatccaagaaagaatcaagggcaacaagtttctcctcgtgctagattatgtgtggagggaagaccaaacaaagtgggagagtttaaggttaccggtactaatgcaaacctgttctgaaggcagtagaattcttgtgaccactcgaacgcaggaggttgctcgaatgatgagagcaaccagggacatgatcactttggagaagttgagtcatatagattctttggaactattctataatgttgcatttctggatagggaacaagaccaacaaggggtttggagatattgctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LRR_8 NB-ARC

Protein Analysis

452

Amino Acids

50.11

Weight (kDa)

6.03

Isoelectric Point (pI)

31.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0025487)

Species Orthologous Gene IDs
rosa_multiflora Rmu_co8511045.1_g000001 Rmu_sc0000721.1_g000008 Rmu_sc0005913.1_g000024

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 351
AccB7I CCANNNNNTGG 2 cut(s) 383, 671
AclWI GGATC 2 cut(s) 374, 642
AcsI RAATTY 2 cut(s) 550, 1194
AcuI CTGAAG 3 cut(s) 44, 468, 1203
AdeI CACNNNGTG 1 cut(s) 171
AfaI GTAC 1 cut(s) 1164
AfiI CCNNNNNNNGG 6 cut(s) 64, 383, 599, 671, 789, 1339
AgeI ACCGGT 2 cut(s) 227, 1159
AgsI TTSAA 7 cut(s) 404, 623, 702, 734, 929, 1007, 1041
AjnI CCWGG 3 cut(s) 149, 525, 1244
AjuI GAANNNNNNNTTGG 2 cut(s) 70, 102
AluBI AGCT 7 cut(s) 41, 135, 463, 481, 574, 800, 950
AluI AGCT 7 cut(s) 41, 135, 463, 481, 574, 800, 950
Alw26I GTCTC 1 cut(s) 392
AlwI GGATC 2 cut(s) 374, 642
ApeKI GCWGC 3 cut(s) 245, 716, 719
ApoI RAATTY 2 cut(s) 550, 1194
AsiGI ACCGGT 2 cut(s) 227, 1159
AspS9I GGNCC 2 cut(s) 225, 653
AsuC2I CCSGG 1 cut(s) 186
AsuHPI GGTGA 4 cut(s) 66, 157, 265, 829
AvaII GGWCC 2 cut(s) 225, 653
BauI CACGAG 2 cut(s) 169, 1103
BbsI GAAGAC 1 cut(s) 1134
BbvI GCAGC 3 cut(s) 232, 703, 706
BccI CCATC 5 cut(s) 305, 665, 697, 776, 865
BciT130I CCWGG 3 cut(s) 151, 527, 1246
BclI TGATCA 1 cut(s) 1254
BcnI CCSGG 1 cut(s) 186
BcoDI GTCTC 1 cut(s) 392
BfaI CTAG 3 cut(s) 38, 503, 1109
BfmI CTRYAG 1 cut(s) 720
BisI GCNGC 3 cut(s) 246, 717, 720
BlsI GCNGC 3 cut(s) 247, 718, 721
Bme1390I CCNGG 4 cut(s) 151, 186, 527, 1246
Bme18I GGWCC 2 cut(s) 225, 653
BmgT120I GGNCC 2 cut(s) 225, 653
BmiI GGNNCC 1 cut(s) 655
BmrFI CCNGG 4 cut(s) 151, 186, 527, 1246
BmrI ACTGGG 1 cut(s) 372
BmsI GCATC 2 cut(s) 907, 1077
BmuI ACTGGG 1 cut(s) 372
BpiI GAAGAC 1 cut(s) 1134
BpuEI CTTGAG 1 cut(s) 1014
BpuMI CCSGG 1 cut(s) 186
Bsa29I ATCGAT 1 cut(s) 771
BsaI GGTCTC 1 cut(s) 392
BsaJI CCNNGG 3 cut(s) 184, 526, 1245
BsaWI WCCGGW 3 cut(s) 227, 261, 1159
BsaXI ACNNNNNCTCC 2 cut(s) 827, 857
Bsc4I CCNNNNNNNGG 6 cut(s) 64, 383, 599, 671, 789, 1339
Bse118I RCCGGY 2 cut(s) 227, 1159
Bse1I ACTGG 2 cut(s) 367, 427
Bse3DI GCAATG 2 cut(s) 223, 247
BseBI CCWGG 3 cut(s) 151, 527, 1246
BseCI ATCGAT 1 cut(s) 771
BseDI CCNNGG 3 cut(s) 184, 526, 1245
BseGI GGATG 7 cut(s) 297, 369, 657, 855, 876, 922, 1068
BseLI CCNNNNNNNGG 6 cut(s) 64, 383, 599, 671, 789, 1339
BseMI GCAATG 2 cut(s) 223, 247
BseMII CTCAG 2 cut(s) 320, 978
BseNI ACTGG 2 cut(s) 367, 427
BseRI GAGGAG 1 cut(s) 1091
BseXI GCAGC 3 cut(s) 232, 703, 706
Bsh1285I CGRYCG 1 cut(s) 783
BshTI ACCGGT 2 cut(s) 227, 1159
BshVI ATCGAT 1 cut(s) 771
BsiEI CGRYCG 1 cut(s) 783
BsiSI CCGG 5 cut(s) 186, 228, 249, 262, 1160
BslFI GGGAC 2 cut(s) 639, 1262
BslI CCNNNNNNNGG 6 cut(s) 64, 383, 599, 671, 789, 1339
BsmAI GTCTC 1 cut(s) 392
BsmFI GGGAC 2 cut(s) 639, 1262
Bso31I GGTCTC 1 cut(s) 392
Bsp143I GATC 3 cut(s) 366, 634, 1254
BspCNI CTCAG 2 cut(s) 319, 977
BspDI ATCGAT 1 cut(s) 771
BspLI GGNNCC 1 cut(s) 655
BspMAI CTGCAG 1 cut(s) 724
BspPI GGATC 2 cut(s) 374, 642
BspTNI GGTCTC 1 cut(s) 392
BsrDI GCAATG 2 cut(s) 223, 247
BsrFI RCCGGY 2 cut(s) 227, 1159
BsrI ACTGG 2 cut(s) 367, 427
BssAI RCCGGY 2 cut(s) 227, 1159
BssECI CCNNGG 3 cut(s) 184, 526, 1245
BssMI GATC 3 cut(s) 366, 634, 1254
BssSI CACGAG 2 cut(s) 169, 1103
Bst2BI CACGAG 2 cut(s) 169, 1103
Bst2UI CCWGG 3 cut(s) 151, 527, 1246
Bst4CI ACNGT 1 cut(s) 784
Bst6I CTCTTC 1 cut(s) 335
BstC8I GCNNGC 6 cut(s) 43, 133, 214, 461, 483, 714
BstDEI CTNAG 2 cut(s) 306, 964
BstEII GGTNACC 1 cut(s) 1155
BstF5I GGATG 7 cut(s) 297, 369, 657, 855, 876, 922, 1068
BstKTI GATC 3 cut(s) 369, 637, 1257
BstMAI GTCTC 1 cut(s) 392
BstMBI GATC 3 cut(s) 366, 634, 1254
BstMCI CGRYCG 1 cut(s) 783
BstNI CCWGG 3 cut(s) 151, 527, 1246
BstNSI RCATGY 1 cut(s) 216
BstPI GGTNACC 1 cut(s) 1155
BstSCI CCNGG 4 cut(s) 149, 184, 525, 1244
BstSFI CTRYAG 1 cut(s) 720
BstV1I GCAGC 3 cut(s) 232, 703, 706
BstV2I GAAGAC 1 cut(s) 1134
BstXI CCANNNNNNTGG 1 cut(s) 434
Bsu15I ATCGAT 1 cut(s) 771
BsuTUI ATCGAT 1 cut(s) 771
BtsCI GGATG 7 cut(s) 297, 369, 657, 855, 876, 922, 1068
BtsIMutI CAGTG 1 cut(s) 1021
Cac8I GCNNGC 6 cut(s) 43, 133, 214, 461, 483, 714
Cfr10I RCCGGY 2 cut(s) 227, 1159
Cfr13I GGNCC 2 cut(s) 225, 653
ClaI ATCGAT 1 cut(s) 771
Csp6I GTAC 1 cut(s) 1163
CspAI ACCGGT 2 cut(s) 227, 1159
CspCI CAANNNNNGTGG 2 cut(s) 1121, 1156
CviAII CATG 4 cut(s) 213, 237, 544, 1252
CviQI GTAC 1 cut(s) 1163
DdeI CTNAG 2 cut(s) 306, 964
DpnI GATC 3 cut(s) 368, 636, 1256
DpnII GATC 3 cut(s) 366, 634, 1254
DraIII CACNNNGTG 1 cut(s) 171
Eam1104I CTCTTC 1 cut(s) 335
EarI CTCTTC 1 cut(s) 335
Eco31I GGTCTC 1 cut(s) 392
Eco32I GATATC 2 cut(s) 943, 1000
Eco47I GGWCC 2 cut(s) 225, 653
Eco57I CTGAAG 3 cut(s) 44, 468, 1203
Eco91I GGTNACC 1 cut(s) 1155
EcoO109I RGGNCCY 1 cut(s) 653
EcoO65I GGTNACC 1 cut(s) 1155
EcoRI GAATTC 1 cut(s) 1194
EcoRII CCWGG 3 cut(s) 149, 525, 1244
EcoRV GATATC 2 cut(s) 943, 1000
FaeI CATG 4 cut(s) 216, 240, 547, 1255
FalI AAGNNNNNCTT 2 cut(s) 987, 1019
FaqI GGGAC 2 cut(s) 639, 1262
FatI CATG 4 cut(s) 212, 236, 543, 1251
FbaI TGATCA 1 cut(s) 1254
Fnu4HI GCNGC 3 cut(s) 246, 717, 720
FokI GGATG 7 cut(s) 284, 356, 644, 842, 883, 929, 1055
Fsp4HI GCNGC 3 cut(s) 246, 717, 720
FspBI CTAG 3 cut(s) 38, 503, 1109
GluI GCNGC 3 cut(s) 246, 717, 720
HapII CCGG 5 cut(s) 186, 228, 249, 262, 1160
Hin1II CATG 4 cut(s) 216, 240, 547, 1255
HincII GTYRAC 1 cut(s) 259
HindII GTYRAC 1 cut(s) 259
HindIII AAGCTT 1 cut(s) 948
HinfI GANTC 6 cut(s) 95, 142, 442, 1080, 1273, 1283
HpaII CCGG 5 cut(s) 186, 228, 249, 262, 1160
HphI GGTGA 4 cut(s) 66, 157, 265, 829
Hpy166II GTNNAC 2 cut(s) 174, 259
Hpy188I TCNGA 5 cut(s) 141, 309, 489, 967, 1183
Hpy188III TCNNGA 7 cut(s) 446, 503, 593, 846, 985, 1031, 1316
Hpy8I GTNNAC 2 cut(s) 174, 259
HpyAV CCTTC 5 cut(s) 18, 68, 500, 532, 1178
HpyCH4III ACNGT 1 cut(s) 784
HpyF3I CTNAG 2 cut(s) 306, 964
Hsp92II CATG 4 cut(s) 216, 240, 547, 1255
Ksp22I TGATCA 1 cut(s) 1254
Kzo9I GATC 3 cut(s) 366, 634, 1254
Lsp1109I GCAGC 3 cut(s) 232, 703, 706
LweI GCATC 2 cut(s) 907, 1077
MaeI CTAG 3 cut(s) 38, 503, 1109
MaeIII GTNAC 2 cut(s) 1155, 1201
MalI GATC 3 cut(s) 368, 636, 1256
MboI GATC 3 cut(s) 366, 634, 1254
MboII GAAGA 5 cut(s) 322, 392, 461, 756, 1139
MfeI CAATTG 1 cut(s) 356
MlyI GAGTC 1 cut(s) 1282
MseI TTAA 6 cut(s) 416, 431, 647, 830, 912, 1151
MspI CCGG 5 cut(s) 186, 228, 249, 262, 1160
MspR9I CCNGG 4 cut(s) 151, 186, 527, 1246
MunI CAATTG 1 cut(s) 356
MvaI CCWGG 3 cut(s) 151, 527, 1246
NciI CCSGG 1 cut(s) 186
NdeII GATC 3 cut(s) 366, 634, 1254
NlaIII CATG 4 cut(s) 216, 240, 547, 1255
NlaIV GGNNCC 1 cut(s) 655
NmuCI GTSAC 1 cut(s) 1201
NspI RCATGY 1 cut(s) 216
PaeI GCATGC 1 cut(s) 216
PfeI GAWTC 5 cut(s) 95, 142, 442, 1080, 1283
PflMI CCANNNNNTGG 2 cut(s) 383, 671
PinAI ACCGGT 2 cut(s) 227, 1159
PkrI GCNGC 3 cut(s) 247, 718, 721
PleI GAGTC 1 cut(s) 1281
PpsI GAGTC 1 cut(s) 1281
PpuMI RGGWCCY 1 cut(s) 653
PsiI TTATAA 1 cut(s) 351
Psp5II RGGWCCY 1 cut(s) 653
Psp6I CCWGG 3 cut(s) 149, 525, 1244
PspEI GGTNACC 1 cut(s) 1155
PspGI CCWGG 3 cut(s) 149, 525, 1244
PspN4I GGNNCC 1 cut(s) 655
PspPI GGNCC 2 cut(s) 225, 653
PspPPI RGGWCCY 1 cut(s) 653
PstI CTGCAG 1 cut(s) 724
RsaI GTAC 1 cut(s) 1164
RsaNI GTAC 1 cut(s) 1163
SaqAI TTAA 6 cut(s) 416, 431, 647, 830, 912, 1151
SatI GCNGC 3 cut(s) 246, 717, 720
Sau3AI GATC 3 cut(s) 366, 634, 1254
Sau96I GGNCC 2 cut(s) 225, 653
SchI GAGTC 1 cut(s) 1282
ScrFI CCNGG 4 cut(s) 151, 186, 527, 1246
SfaNI GCATC 2 cut(s) 907, 1077
SfcI CTRYAG 1 cut(s) 720
SinI GGWCC 2 cut(s) 225, 653
SmlI CTYRAG 1 cut(s) 1029
SmoI CTYRAG 1 cut(s) 1029
SphI GCATGC 1 cut(s) 216
SspMI CTAG 3 cut(s) 38, 503, 1109
StyD4I CCNGG 4 cut(s) 149, 184, 525, 1244
TaaI ACNGT 1 cut(s) 784
TaqI TCGA 5 cut(s) 440, 771, 779, 1210, 1228
TfiI GAWTC 5 cut(s) 95, 142, 442, 1080, 1283
Tru1I TTAA 6 cut(s) 416, 431, 647, 830, 912, 1151
Tru9I TTAA 6 cut(s) 416, 431, 647, 830, 912, 1151
TscAI CASTG 1 cut(s) 1021
TseFI GTSAC 1 cut(s) 1201
TseI GCWGC 3 cut(s) 245, 716, 719
Tsp45I GTSAC 1 cut(s) 1201
TspDTI ATGAA 5 cut(s) 17, 60, 192, 225, 750
TspGWI ACGGA 1 cut(s) 435
TspRI CASTG 1 cut(s) 1021
Van91I CCANNNNNTGG 2 cut(s) 383, 671
VpaK11BI GGWCC 2 cut(s) 225, 653
XapI RAATTY 2 cut(s) 550, 1194
XbaI TCTAGA 1 cut(s) 502
XceI RCATGY 1 cut(s) 216
XspI CTAG 3 cut(s) 38, 503, 1109
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.