Rmu_sc0000015.1_g000007

Serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000015.1
Physical Location & Seq
Reverse (-)
23073 .. 23339
267 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000015.1_g000007.1.cds

Sequence Viewer

Length: 267 bp
atgcatacagagaatgggagcgaagtgatgtactacttgctgcctaagttcaccatgagcgacctagaagctgccacggaggacttcttgccggagaacattgtttcggcaagtggagagaaatttcccaatgtggtgtacagaggcaagctcaaagacggccgttgggtggctgtcaagcgtttcacgtactcagcttggcctgattcgtaccaatttcttgtatggataaatttgcttaatttcctctttttgtttcgtgtgtaa

Protein Analysis

88

Amino Acids

10.35

Weight (kDa)

5.71

Isoelectric Point (pI)

43.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0031030)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0000015.1_g000007
rosa_samantha Rh5AG443200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 160
AcsI RAATTY 2 cut(s) 122, 232
AfaI GTAC 4 cut(s) 32, 140, 191, 212
AfiI CCNNNNNNNGG 1 cut(s) 169
AluBI AGCT 3 cut(s) 71, 151, 197
AluI AGCT 3 cut(s) 71, 151, 197
AoxI GGCC 2 cut(s) 160, 200
ApeKI GCWGC 2 cut(s) 40, 71
ApoI RAATTY 2 cut(s) 122, 232
AsuHPI GGTGA 1 cut(s) 43
BbvI GCAGC 2 cut(s) 27, 58
BceAI ACGGC 2 cut(s) 147, 175
BfaI CTAG 1 cut(s) 65
BisI GCNGC 2 cut(s) 41, 72
BlsI GCNGC 2 cut(s) 42, 73
BplI GAGNNNNNCTC 2 cut(s) 135, 167
BsaAI YACGTR 1 cut(s) 189
BsaJI CCNNGG 1 cut(s) 75
Bsc4I CCNNNNNNNGG 1 cut(s) 169
BseDI CCNNGG 1 cut(s) 75
BseLI CCNNNNNNNGG 1 cut(s) 169
BseMII CTCAG 1 cut(s) 207
BseX3I CGGCCG 1 cut(s) 160
BseXI GCAGC 2 cut(s) 27, 58
Bsh1285I CGRYCG 1 cut(s) 163
BshFI GGCC 2 cut(s) 162, 202
BsiEI CGRYCG 1 cut(s) 163
BsiSI CCGG 1 cut(s) 92
BslI CCNNNNNNNGG 1 cut(s) 169
BsnI GGCC 2 cut(s) 162, 202
Bsp1407I TGTACA 1 cut(s) 138
BspANI GGCC 2 cut(s) 162, 202
BspCNI CTCAG 1 cut(s) 206
BsrGI TGTACA 1 cut(s) 138
BssECI CCNNGG 1 cut(s) 75
BstAUI TGTACA 1 cut(s) 138
BstBAI YACGTR 1 cut(s) 189
BstC8I GCNNGC 1 cut(s) 149
BstDEI CTNAG 2 cut(s) 45, 193
BstDSI CCRYGG 1 cut(s) 75
BstMCI CGRYCG 1 cut(s) 163
BstV1I GCAGC 2 cut(s) 27, 58
BstZI CGGCCG 1 cut(s) 160
BsuRI GGCC 2 cut(s) 162, 202
BtgI CCRYGG 1 cut(s) 75
Cac8I GCNNGC 1 cut(s) 149
Csp6I GTAC 4 cut(s) 31, 139, 190, 211
CviAII CATG 1 cut(s) 55
CviJI RGCY 6 cut(s) 71, 151, 162, 173, 197, 202
CviKI_1 RGCY 6 cut(s) 71, 151, 162, 173, 197, 202
CviQI GTAC 4 cut(s) 31, 139, 190, 211
DdeI CTNAG 2 cut(s) 45, 193
EaeI YGGCCR 1 cut(s) 160
EagI CGGCCG 1 cut(s) 160
EclXI CGGCCG 1 cut(s) 160
Eco52I CGGCCG 1 cut(s) 160
EcoT22I ATGCAT 1 cut(s) 6
FaeI CATG 1 cut(s) 58
FaiI YATR 3 cut(s) 6, 56, 226
FatI CATG 1 cut(s) 54
Fnu4HI GCNGC 2 cut(s) 41, 72
Fsp4HI GCNGC 2 cut(s) 41, 72
FspBI CTAG 1 cut(s) 65
GluI GCNGC 2 cut(s) 41, 72
HaeIII GGCC 2 cut(s) 162, 202
HapII CCGG 1 cut(s) 92
Hin1II CATG 1 cut(s) 58
HinfI GANTC 1 cut(s) 206
HpaII CCGG 1 cut(s) 92
HphI GGTGA 1 cut(s) 43
Hpy166II GTNNAC 2 cut(s) 51, 139
Hpy8I GTNNAC 2 cut(s) 51, 139
HpyCH4IV ACGT 1 cut(s) 188
HpyCH4V TGCA 1 cut(s) 4
HpyF3I CTNAG 2 cut(s) 45, 193
HpySE526I ACGT 1 cut(s) 188
Hsp92II CATG 1 cut(s) 58
LmnI GCTCC 1 cut(s) 18
LpnPI CCDG 2 cut(s) 105, 216
Lsp1109I GCAGC 2 cut(s) 27, 58
MaeI CTAG 1 cut(s) 65
MaeII ACGT 1 cut(s) 188
MluCI AATT 4 cut(s) 122, 215, 232, 241
MnlI CCTC 3 cut(s) 73, 137, 257
Mph1103I ATGCAT 1 cut(s) 6
MseI TTAA 1 cut(s) 240
MspI CCGG 1 cut(s) 92
NlaIII CATG 1 cut(s) 58
NsiI ATGCAT 1 cut(s) 6
PfeI GAWTC 1 cut(s) 206
PkrI GCNGC 2 cut(s) 42, 73
Ppu21I YACGTR 1 cut(s) 189
RsaI GTAC 4 cut(s) 32, 140, 191, 212
RsaNI GTAC 4 cut(s) 31, 139, 190, 211
SaqAI TTAA 1 cut(s) 240
SatI GCNGC 2 cut(s) 41, 72
SetI ASST 5 cut(s) 66, 73, 153, 191, 199
Sse9I AATT 4 cut(s) 122, 215, 232, 241
SspMI CTAG 1 cut(s) 65
TaiI ACGT 1 cut(s) 191
TasI AATT 4 cut(s) 122, 215, 232, 241
TatI WGTACW 2 cut(s) 30, 138
TfiI GAWTC 1 cut(s) 206
Tru1I TTAA 1 cut(s) 240
Tru9I TTAA 1 cut(s) 240
TseI GCWGC 2 cut(s) 40, 71
TspGWI ACGGA 1 cut(s) 92
XapI RAATTY 2 cut(s) 122, 232
XspI CTAG 1 cut(s) 65
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.