Rmu_sc0000331.1_g000006

Chloroplastic group IIA intron splicing facilitator CRS1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000331.1
OG0025478
Physical Location & Seq
Forward (+)
33877 .. 34938
1062 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 789 bp
atgcttccaattcaatggcgaggtcattcatgcgagtttctttctgtccgagtgaaattcgtacagaatttcgattcaactcagatggtctctcttctctgttctctgaaagctcgcgtcttggttgggttttcgaaacagaaagaggaagttgatagaaatgggaaattggagagagcaattgatggggtttcacaagaggaaaagataataatttcgaaaagcttcgaacatagaaatggcaaattagagggacagattgatggaatttcagttggtgtttcaaaaaagcaggggatggtgatttcaaaaggcttaattggggctgctgtggatgaaattctatctggggatagtgaaaatgatgaaaatgtggaaccttttgtgtcttctggtcgtgattctcatgcttctactcggttgccttgggagagagaaggtgaattgggtaatggggaaggtggtaagacaataaagatctggaataatacgctttcggttgaggcatcccttccggagcatgagttgaagaggctaaggaatgtttatttgaggatgttggaaaggactaaagtcggagctgccggtatcacacagggtttggtggatgctatacatgagaagtggaaggtggatgaagtggtcaagttgaagtttgaggagccactctcacttaacatgaaaagaactcatggcatcttagagtctcagctgactagtattgtctgtattcttttgaattggagatgcaataatgatgttgataatagctatgttgtatattgttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
CRS1_YhbY

Protein Analysis

262

Amino Acids

29.35

Weight (kDa)

6.34

Isoelectric Point (pI)

21.01

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CRS1_YhbY PF01985 171 - 241 1.1e-11 CRS1 / YhbY (CRM) domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0025478)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0000331.1_g000006 Rmu_sc0004836.1_g000002 Rmu_sc0017886.1_g000001

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 117
AccIII TCCGGA 1 cut(s) 514
AcsI RAATTY 4 cut(s) 56, 67, 267, 339
AfaI GTAC 1 cut(s) 63
AgsI TTSAA 7 cut(s) 14, 78, 285, 309, 529, 652, 739
AhlI ACTAGT 1 cut(s) 716
AluBI AGCT 5 cut(s) 113, 225, 581, 712, 771
AluI AGCT 5 cut(s) 113, 225, 581, 712, 771
Alw26I GTCTC 2 cut(s) 94, 711
Aor13HI TCCGGA 1 cut(s) 514
ApeKI GCWGC 2 cut(s) 326, 581
ApoI RAATTY 4 cut(s) 56, 67, 267, 339
Asp700I GAANNNNTTC 1 cut(s) 224
AsuHPI GGTGA 2 cut(s) 313, 452
AsuII TTCGAA 3 cut(s) 134, 218, 228
BbsI GAAGAC 1 cut(s) 381
BbvI GCAGC 2 cut(s) 313, 568
BccI CCATC 4 cut(s) 79, 179, 257, 292
BcoDI GTCTC 2 cut(s) 94, 711
BcuI ACTAGT 1 cut(s) 716
BfaI CTAG 1 cut(s) 717
BglII AGATCT 1 cut(s) 477
BisI GCNGC 2 cut(s) 327, 582
BlsI GCNGC 2 cut(s) 328, 583
BmiI GGNNCC 2 cut(s) 378, 663
BmsI GCATC 4 cut(s) 515, 598, 705, 737
BoxI GACNNNNGTC 1 cut(s) 572
BpiI GAAGAC 1 cut(s) 381
BplI GAGNNNNNCTC 2 cut(s) 653, 685
Bpu10I CCTNAGC 1 cut(s) 536
Bpu14I TTCGAA 3 cut(s) 134, 218, 228
BsaI GGTCTC 1 cut(s) 94
BsaJI CCNNGG 1 cut(s) 425
BsaWI WCCGGW 1 cut(s) 514
BsaXI ACNNNNNCTCC 2 cut(s) 509, 539
Bse118I RCCGGY 1 cut(s) 584
BseAI TCCGGA 1 cut(s) 514
BseDI CCNNGG 1 cut(s) 425
BseGI GGATG 6 cut(s) 303, 340, 506, 561, 613, 640
BseMII CTCAG 2 cut(s) 95, 722
BseRI GAGGAG 1 cut(s) 674
BseXI GCAGC 2 cut(s) 313, 568
Bsh1236I CGCG 1 cut(s) 117
BsiSI CCGG 2 cut(s) 515, 585
BslFI GGGAC 1 cut(s) 267
BsmAI GTCTC 2 cut(s) 94, 711
BsmFI GGGAC 1 cut(s) 267
Bso31I GGTCTC 1 cut(s) 94
Bsp119I TTCGAA 3 cut(s) 134, 218, 228
Bsp13I TCCGGA 1 cut(s) 514
Bsp143I GATC 1 cut(s) 477
BspCNI CTCAG 2 cut(s) 94, 721
BspEI TCCGGA 1 cut(s) 514
BspFNI CGCG 1 cut(s) 117
BspLI GGNNCC 2 cut(s) 378, 663
BspT104I TTCGAA 3 cut(s) 134, 218, 228
BspTNI GGTCTC 1 cut(s) 94
BsrFI RCCGGY 1 cut(s) 584
BssAI RCCGGY 1 cut(s) 584
BssECI CCNNGG 1 cut(s) 425
BssMI GATC 1 cut(s) 477
BssT1I CCWWGG 1 cut(s) 425
Bst6I CTCTTC 2 cut(s) 99, 524
BstBI TTCGAA 3 cut(s) 134, 218, 228
BstC8I GCNNGC 1 cut(s) 115
BstDEI CTNAG 4 cut(s) 81, 536, 700, 708
BstF5I GGATG 6 cut(s) 303, 340, 506, 561, 613, 640
BstFNI CGCG 1 cut(s) 117
BstKTI GATC 1 cut(s) 480
BstMAI GTCTC 2 cut(s) 94, 711
BstMBI GATC 1 cut(s) 477
BstPAI GACNNNNGTC 1 cut(s) 572
BstUI CGCG 1 cut(s) 117
BstV1I GCAGC 2 cut(s) 313, 568
BstV2I GAAGAC 1 cut(s) 381
BstX2I RGATCY 1 cut(s) 477
BstXI CCANNNNNNTGG 1 cut(s) 15
BstYI RGATCY 1 cut(s) 477
BtsCI GGATG 6 cut(s) 303, 340, 506, 561, 613, 640
Cac8I GCNNGC 1 cut(s) 115
Cfr10I RCCGGY 1 cut(s) 584
CseI GACGC 1 cut(s) 106
Csp6I GTAC 1 cut(s) 62
CviAII CATG 6 cut(s) 30, 407, 521, 617, 679, 692
CviJI RGCY 9 cut(s) 113, 225, 315, 326, 535, 581, 664, 712, 771
CviKI_1 RGCY 9 cut(s) 113, 225, 315, 326, 535, 581, 664, 712, 771
CviQI GTAC 1 cut(s) 62
DdeI CTNAG 4 cut(s) 81, 536, 700, 708
DpnI GATC 1 cut(s) 479
DpnII GATC 1 cut(s) 477
Eam1104I CTCTTC 2 cut(s) 99, 524
EarI CTCTTC 2 cut(s) 99, 524
Eco130I CCWWGG 1 cut(s) 425
Eco31I GGTCTC 1 cut(s) 94
EcoT14I CCWWGG 1 cut(s) 425
ErhI CCWWGG 1 cut(s) 425
FaeI CATG 6 cut(s) 33, 410, 524, 620, 682, 695
FaqI GGGAC 1 cut(s) 267
FatI CATG 6 cut(s) 29, 406, 520, 616, 678, 691
Fnu4HI GCNGC 2 cut(s) 327, 582
FokI GGATG 6 cut(s) 310, 347, 493, 568, 620, 647
Fsp4HI GCNGC 2 cut(s) 327, 582
FspBI CTAG 1 cut(s) 717
GluI GCNGC 2 cut(s) 327, 582
HapII CCGG 2 cut(s) 515, 585
HgaI GACGC 1 cut(s) 106
Hin1II CATG 6 cut(s) 33, 410, 524, 620, 682, 695
HindIII AAGCTT 1 cut(s) 223
HinfI GANTC 3 cut(s) 74, 401, 704
HpaII CCGG 2 cut(s) 515, 585
HphI GGTGA 2 cut(s) 313, 452
Hpy188I TCNGA 4 cut(s) 50, 84, 108, 578
Hpy188III TCNNGA 3 cut(s) 398, 481, 515
HpyAV CCTTC 4 cut(s) 431, 452, 521, 622
HpyCH4V TGCA 1 cut(s) 750
HpyF3I CTNAG 4 cut(s) 81, 536, 700, 708
Hsp92II CATG 6 cut(s) 33, 410, 524, 620, 682, 695
Kpn2I TCCGGA 1 cut(s) 514
Kzo9I GATC 1 cut(s) 477
LmnI GCTCC 3 cut(s) 517, 578, 661
LpnPI CCDG 7 cut(s) 278, 333, 378, 466, 528, 581, 598
Lsp1109I GCAGC 2 cut(s) 313, 568
LweI GCATC 4 cut(s) 515, 598, 705, 737
MaeI CTAG 1 cut(s) 717
MalI GATC 1 cut(s) 479
MboI GATC 1 cut(s) 477
MboII GAAGA 3 cut(s) 86, 381, 541
MfeI CAATTG 1 cut(s) 180
MflI RGATCY 1 cut(s) 477
MlyI GAGTC 1 cut(s) 713
MmeI TCCRAC 2 cut(s) 540, 556
MnlI CCTC 8 cut(s) 14, 139, 193, 244, 496, 525, 546, 652
MroI TCCGGA 1 cut(s) 514
MroXI GAANNNNTTC 1 cut(s) 224
MseI TTAA 3 cut(s) 317, 675, 787
MslI CAYNNNNRTG 1 cut(s) 237
MspA1I CMGCKG 1 cut(s) 712
MspI CCGG 2 cut(s) 515, 585
MunI CAATTG 1 cut(s) 180
MvnI CGCG 1 cut(s) 117
NdeII GATC 1 cut(s) 477
NlaIII CATG 6 cut(s) 33, 410, 524, 620, 682, 695
NlaIV GGNNCC 2 cut(s) 378, 663
NspV TTCGAA 3 cut(s) 134, 218, 228
PdmI GAANNNNTTC 1 cut(s) 224
PfeI GAWTC 2 cut(s) 74, 401
PkrI GCNGC 2 cut(s) 328, 583
PleI GAGTC 1 cut(s) 712
PpsI GAGTC 1 cut(s) 712
PshAI GACNNNNGTC 1 cut(s) 572
PspN4I GGNNCC 2 cut(s) 378, 663
PsuI RGATCY 1 cut(s) 477
PvuII CAGCTG 1 cut(s) 712
RsaI GTAC 1 cut(s) 63
RsaNI GTAC 1 cut(s) 62
RseI CAYNNNNRTG 1 cut(s) 237
SaqAI TTAA 3 cut(s) 317, 675, 787
SatI GCNGC 2 cut(s) 327, 582
Sau3AI GATC 1 cut(s) 477
SchI GAGTC 1 cut(s) 713
SfaNI GCATC 4 cut(s) 515, 598, 705, 737
SfuI TTCGAA 3 cut(s) 134, 218, 228
SmiMI CAYNNNNRTG 1 cut(s) 237
SpeI ACTAGT 1 cut(s) 716
SspMI CTAG 1 cut(s) 717
StyI CCWWGG 1 cut(s) 425
TaqI TCGA 4 cut(s) 72, 134, 218, 228
TfiI GAWTC 2 cut(s) 74, 401
Tru1I TTAA 3 cut(s) 317, 675, 787
Tru9I TTAA 3 cut(s) 317, 675, 787
TseI GCWGC 2 cut(s) 326, 581
TspDTI ATGAA 5 cut(s) 18, 351, 381, 651, 695
XapI RAATTY 4 cut(s) 56, 67, 267, 339
XmnI GAANNNNTTC 1 cut(s) 224
XspI CTAG 1 cut(s) 717
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.