Rmu_sc0000345.1_g000002

squalene

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000345.1
OG0031064
Physical Location & Seq
Reverse (-)
3077 .. 3544
468 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 363 bp
atggaacaaggatcagtgacaacactaatagaggaaaagggcattattaaaggggtgatttacaagaacaagactggagaggagatgagaacatgtgctcctctaacaatcgtgtgcgatggctatttttcaaatttgtgcaaatctcttagtgctccaaaggttgaaagtccatcttgttttgttggtttgatcttggaggactgtgagcttcatgggcatgtcattctgggagacccttcaccaatcctgttttatcccatcagttccactgaggttcgctgtttggtagatgtgcctagaacaaaagtaccttcactagctagtggtgaaatggccaactatttgaagctcctcaggtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00100 ko00909 ko01100 ko01110 ko01130 map00100 map00909 map01100 map01110 map01130
Pfam Domains
Protein Families
SE

Protein Analysis

120

Amino Acids

13.11

Weight (kDa)

5.66

Isoelectric Point (pI)

50.86

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SE PF08491 33 - 117 1.4e-29 Squalene epoxidase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0031064)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0000345.1_g000002
rosa_wichuraiana Rw6G003120

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 19
AcoI YGGCCR 1 cut(s) 336
AcsI RAATTY 1 cut(s) 133
AfaI GTAC 1 cut(s) 312
AflIII ACRYGT 1 cut(s) 92
AgsI TTSAA 3 cut(s) 132, 167, 349
AloI GAACNNNNNNTCC 2 cut(s) 82, 114
AluBI AGCT 3 cut(s) 211, 323, 352
AluI AGCT 3 cut(s) 211, 323, 352
Alw21I GWGCWC 2 cut(s) 100, 157
Alw26I GTCTC 1 cut(s) 228
AlwI GGATC 1 cut(s) 19
AoxI GGCC 1 cut(s) 336
ApoI RAATTY 1 cut(s) 133
AsuHPI GGTGA 3 cut(s) 67, 234, 341
AxyI CCTNAGG 1 cut(s) 356
BaeI ACNNNNGTAYC 2 cut(s) 294, 327
BalI TGGCCA 1 cut(s) 338
Bbv12I GWGCWC 2 cut(s) 100, 157
BccI CCATC 3 cut(s) 113, 181, 269
BcoDI GTCTC 1 cut(s) 228
BfaI CTAG 3 cut(s) 300, 320, 324
BpmI CTGGAG 1 cut(s) 96
BsaI GGTCTC 1 cut(s) 228
BsaXI ACNNNNNCTCC 2 cut(s) 82, 112
Bse1I ACTGG 1 cut(s) 79
Bse21I CCTNAGG 1 cut(s) 356
BseMII CTCAG 1 cut(s) 264
BseNI ACTGG 1 cut(s) 79
BseRI GAGGAG 3 cut(s) 90, 95, 344
BshFI GGCC 1 cut(s) 338
BsiHKAI GWGCWC 2 cut(s) 100, 157
BsmAI GTCTC 1 cut(s) 228
BsnI GGCC 1 cut(s) 338
Bso31I GGTCTC 1 cut(s) 228
Bsp1286I GDGCHC 2 cut(s) 100, 157
Bsp143I GATC 2 cut(s) 11, 192
BspANI GGCC 1 cut(s) 338
BspCNI CTCAG 1 cut(s) 265
BspPI GGATC 1 cut(s) 19
BspTNI GGTCTC 1 cut(s) 228
BsrI ACTGG 1 cut(s) 79
BssMI GATC 2 cut(s) 11, 192
Bst4CI ACNGT 1 cut(s) 206
BstDEI CTNAG 3 cut(s) 149, 273, 356
BstKTI GATC 2 cut(s) 14, 195
BstMAI GTCTC 1 cut(s) 228
BstMBI GATC 2 cut(s) 11, 192
BstMWI GCNNNNNNNGC 1 cut(s) 217
BstNSI RCATGY 2 cut(s) 96, 224
Bsu36I CCTNAGG 1 cut(s) 356
BsuRI GGCC 1 cut(s) 338
BtgZI GCGATG 1 cut(s) 132
BtsIMutI CAGTG 2 cut(s) 21, 270
Csp6I GTAC 1 cut(s) 311
CviAII CATG 3 cut(s) 93, 215, 221
CviJI RGCY 5 cut(s) 123, 211, 323, 338, 352
CviKI_1 RGCY 5 cut(s) 123, 211, 323, 338, 352
CviQI GTAC 1 cut(s) 311
DdeI CTNAG 3 cut(s) 149, 273, 356
DpnI GATC 2 cut(s) 13, 194
DpnII GATC 2 cut(s) 11, 192
EaeI YGGCCR 1 cut(s) 336
Eco31I GGTCTC 1 cut(s) 228
Eco81I CCTNAGG 1 cut(s) 356
FaeI CATG 3 cut(s) 96, 218, 224
FaiI YATR 3 cut(s) 94, 216, 222
FalI AAGNNNNNCTT 2 cut(s) 160, 192
FatI CATG 3 cut(s) 92, 214, 220
FspBI CTAG 3 cut(s) 300, 320, 324
GsuI CTGGAG 1 cut(s) 96
HaeIII GGCC 1 cut(s) 338
Hin1II CATG 3 cut(s) 96, 218, 224
HphI GGTGA 3 cut(s) 67, 234, 341
HpyAV CCTTC 2 cut(s) 249, 324
HpyCH4III ACNGT 1 cut(s) 206
HpyCH4V TGCA 1 cut(s) 141
HpyF10VI GCNNNNNNNGC 1 cut(s) 217
HpyF3I CTNAG 3 cut(s) 149, 273, 356
Hsp92II CATG 3 cut(s) 96, 218, 224
Kzo9I GATC 2 cut(s) 11, 192
LmnI GCTCC 3 cut(s) 103, 160, 357
LpnPI CCDG 4 cut(s) 60, 215, 263, 343
MaeI CTAG 3 cut(s) 300, 320, 324
MaeIII GTNAC 1 cut(s) 16
MalI GATC 2 cut(s) 13, 194
MboI GATC 2 cut(s) 11, 192
MhlI GDGCHC 2 cut(s) 100, 157
MlsI TGGCCA 1 cut(s) 338
MluCI AATT 1 cut(s) 133
MluNI TGGCCA 1 cut(s) 338
MnlI CCTC 5 cut(s) 25, 73, 111, 193, 268
Mox20I TGGCCA 1 cut(s) 338
MscI TGGCCA 1 cut(s) 338
MseI TTAA 1 cut(s) 48
MslI CAYNNNNRTG 1 cut(s) 219
Msp20I TGGCCA 1 cut(s) 338
MwoI GCNNNNNNNGC 1 cut(s) 217
NdeII GATC 2 cut(s) 11, 192
NlaIII CATG 3 cut(s) 96, 218, 224
NmuCI GTSAC 1 cut(s) 16
NspI RCATGY 2 cut(s) 96, 224
PciI ACATGT 1 cut(s) 92
PscI ACATGT 1 cut(s) 92
RsaI GTAC 1 cut(s) 312
RsaNI GTAC 1 cut(s) 311
RseI CAYNNNNRTG 1 cut(s) 219
SaqAI TTAA 1 cut(s) 48
Sau3AI GATC 2 cut(s) 11, 192
SduI GDGCHC 2 cut(s) 100, 157
SetI ASST 7 cut(s) 165, 213, 279, 316, 325, 354, 362
SmiMI CAYNNNNRTG 1 cut(s) 219
Sse9I AATT 1 cut(s) 133
SspMI CTAG 3 cut(s) 300, 320, 324
TaaI ACNGT 1 cut(s) 206
TasI AATT 1 cut(s) 133
Tru1I TTAA 1 cut(s) 48
Tru9I TTAA 1 cut(s) 48
TscAI CASTG 2 cut(s) 21, 277
TseFI GTSAC 1 cut(s) 16
Tsp45I GTSAC 1 cut(s) 16
TspDTI ATGAA 1 cut(s) 203
TspRI CASTG 2 cut(s) 21, 277
XapI RAATTY 1 cut(s) 133
XceI RCATGY 2 cut(s) 96, 224
XspI CTAG 3 cut(s) 300, 320, 324
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.