Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000367.1

Orthogroup ID

OG0023556

Physical Location & Seq

Genomic Coordinates Reverse (-)

738974 .. 739303

Gene Structure 330 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 330 bp

atgtcgtccccctcatccacacgcactgttaaagccatttcggaggtggaagctttcacatcgagtgcagaggacttaaagtttgtggtatcaaaacttagacgacacacattcaaattttactcgcagcagttgcaaacatgggctgcatttgtcatacaagccgcttggcacaggtgtaagaggatgaagcaagccgctaaagtgcaagatagtcatcagagtctcataccaccacctgtctctttctggaaaaagtatggagagaagttggtgcaggccctaaaccctcgtccaaatgtcgtccccctcatccacacgcactgttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0005215 GO:0005216 GO:0005261 GO:0005262 GO:0005488 GO:0005515 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005635 GO:0006810 GO:0006811 GO:0006812 GO:0006816 GO:0008150 GO:0008324 GO:0009877 GO:0012505 GO:0015075 GO:0015085 GO:0015267 GO:0015318 GO:0016020 GO:0022803 GO:0022838 GO:0022857 GO:0022890 GO:0030001 GO:0031090 GO:0031965 GO:0031967 GO:0031975 GO:0034220 GO:0036377 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044325 GO:0044403 GO:0044419 GO:0044422 GO:0044424 GO:0044428 GO:0044446 GO:0044464 GO:0046873 GO:0051179 GO:0051234 GO:0051704 GO:0055085 GO:0070588 GO:0070838 GO:0072511 GO:0098655 GO:0098660 GO:0098662

KEGG Pathways

Metabolic & Signaling

ko04626 map04626

Pfam Domains

Protein Families

Ion_trans cNMP_binding

Protein Analysis

109

Amino Acids

12.49

Weight (kDa)

10.15

Isoelectric Point (pI)

61.28

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0023556)

Species	Orthologous Gene IDs
malus_domestica	MD01G1217500.v1.1
rosa_multiflora	Rmu_sc0000367.1_g000150 Rmu_sc0022251.1_g000003

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	2 cut(s)	165, 198
AcsI	RAATTY	1 cut(s)	116
AgsI	TTSAA	1 cut(s)	115
AluBI	AGCT	1 cut(s)	53
AluI	AGCT	1 cut(s)	53
Alw26I	GTCTC	2 cut(s)	230, 247
AoxI	GGCC	1 cut(s)	279
ApeKI	GCWGC	2 cut(s)	127, 146
ApoI	RAATTY	1 cut(s)	116
ArsI	GACNNNNNNTTYG	2 cut(s)	65, 97
AspS9I	GGNCC	1 cut(s)	280
BbvI	GCAGC	2 cut(s)	133, 139
BcoDI	GTCTC	2 cut(s)	230, 247
BisI	GCNGC	4 cut(s)	128, 147, 165, 198
BlsI	GCNGC	4 cut(s)	129, 148, 166, 199
BmgT120I	GGNCC	1 cut(s)	280
BsaBI	GATNNNNATC	1 cut(s)	216
Bse8I	GATNNNNATC	1 cut(s)	216
BseGI	GGATG	3 cut(s)	14, 192, 312
BseJI	GATNNNNATC	1 cut(s)	216
BseXI	GCAGC	2 cut(s)	133, 139
BsgI	GTGCAG	2 cut(s)	87, 296
BshFI	GGCC	1 cut(s)	281
BslFI	GGGAC	1 cut(s)	290
BsmAI	GTCTC	2 cut(s)	230, 247
BsmFI	GGGAC	1 cut(s)	290
BsnI	GGCC	1 cut(s)	281
BspACI	CCGC	2 cut(s)	165, 198
BspANI	GGCC	1 cut(s)	281
Bst4CI	ACNGT	2 cut(s)	28, 326
BstAPI	GCANNNNNTGC	1 cut(s)	133
BstC8I	GCNNGC	2 cut(s)	195, 279
BstDEI	CTNAG	1 cut(s)	98
BstF5I	GGATG	3 cut(s)	14, 192, 312
BstMAI	GTCTC	2 cut(s)	230, 247
BstMWI	GCNNNNNNNGC	1 cut(s)	133
BstV1I	GCAGC	2 cut(s)	133, 139
BsuRI	GGCC	1 cut(s)	281
BtsCI	GGATG	3 cut(s)	14, 192, 312
BtsIMutI	CAGTG	2 cut(s)	24, 322
Cac8I	GCNNGC	2 cut(s)	195, 279
Cfr13I	GGNCC	1 cut(s)	280
CviAII	CATG	1 cut(s)	141
CviJI	RGCY	6 cut(s)	35, 53, 146, 164, 197, 281
CviKI_1	RGCY	6 cut(s)	35, 53, 146, 164, 197, 281
DdeI	CTNAG	1 cut(s)	98
EcoO109I	RGGNCCY	1 cut(s)	280
FaeI	CATG	1 cut(s)	144
FaiI	YATR	4 cut(s)	142, 158, 230, 261
FaqI	GGGAC	1 cut(s)	290
FatI	CATG	1 cut(s)	140
Fnu4HI	GCNGC	4 cut(s)	128, 147, 165, 198
FokI	GGATG	2 cut(s)	199, 299
Fsp4HI	GCNGC	4 cut(s)	128, 147, 165, 198
GluI	GCNGC	4 cut(s)	128, 147, 165, 198
HaeIII	GGCC	1 cut(s)	281
Hin1II	CATG	1 cut(s)	144
HindIII	AAGCTT	1 cut(s)	51
HinfI	GANTC	1 cut(s)	223
Hpy188I	TCNGA	2 cut(s)	43, 222
Hpy188III	TCNNGA	1 cut(s)	250
HpyCH4III	ACNGT	2 cut(s)	28, 326
HpyCH4V	TGCA	5 cut(s)	68, 136, 149, 208, 277
HpyF10VI	GCNNNNNNNGC	1 cut(s)	133
HpyF3I	CTNAG	1 cut(s)	98
Hsp92II	CATG	1 cut(s)	144
LpnPI	CCDG	4 cut(s)	160, 235, 252, 263
Lsp1109I	GCAGC	2 cut(s)	133, 139
MluCI	AATT	1 cut(s)	116
MlyI	GAGTC	1 cut(s)	232
MnlI	CCTC	6 cut(s)	22, 37, 64, 177, 300, 320
MseI	TTAA	3 cut(s)	30, 77, 328
MwoI	GCNNNNNNNGC	1 cut(s)	133
NlaIII	CATG	1 cut(s)	144
PkrI	GCNGC	4 cut(s)	129, 148, 166, 199
PleI	GAGTC	1 cut(s)	231
PpsI	GAGTC	1 cut(s)	231
PspPI	GGNCC	1 cut(s)	280
SaqAI	TTAA	3 cut(s)	30, 77, 328
SatI	GCNGC	4 cut(s)	128, 147, 165, 198
Sau96I	GGNCC	1 cut(s)	280
SchI	GAGTC	1 cut(s)	232
SetI	ASST	4 cut(s)	48, 55, 179, 241
Sse9I	AATT	1 cut(s)	116
SsiI	CCGC	2 cut(s)	165, 198
TaaI	ACNGT	2 cut(s)	28, 326
TaqI	TCGA	1 cut(s)	62
TasI	AATT	1 cut(s)	116
TauI	GCSGC	2 cut(s)	167, 200
Tru1I	TTAA	3 cut(s)	30, 77, 328
Tru9I	TTAA	3 cut(s)	30, 77, 328
TscAI	CASTG	2 cut(s)	31, 329
TseI	GCWGC	2 cut(s)	127, 146
TspDTI	ATGAA	1 cut(s)	203
TspRI	CASTG	2 cut(s)	31, 329
XapI	RAATTY	1 cut(s)	116
XcmI	CCANNNNNNNNNTGG	1 cut(s)	43

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.